Produkte

. Packing 2ug . Function Bovine source gene yeast expression plasmid . Resistance Amp . Screen URA3 . Strain DH5alpha . Culture temperature 37degrees centigrade . Replicon pUC . Copy . Promoter . Induction . Forward primer T7 . Reverse primer

. Promoter: CMV . Replicon: pUC . Prokaryotic resistance: Kan . Host: mammalian cells . Vector type: Protein expression . Fragment type: ORF . species: Rat . Prokaryotic resistance: Kan . Resistance Marker: G418 . Fluorescent labeling: Red fluorescence . For Lab research use only

. Function Promoter plasmid . Resistance Amp . Screen Hyg . Strain DH5alpha . Culture temperature 37degrees centigrade . Replicon . Copy . Promoter . Induction . Forward primer . Reverse primer

. Function Promoter plasmid . Resistance Amp . Screen Hyg . Strain DH5alpha . Culture temperature 37degrees centigrade . Replicon . Copy . Promoter . Induction . Forward primer . Reverse primer

. Function Promoter plasmid . Resistance Amp . Screen Hyg . Strain DH5alpha . Culture temperature 37degrees centigrade . Replicon . Copy . Promoter . Induction . Forward primer . Reverse primer

. lias:No.102566 . Clone strain:Stbl3 . Culture conditions:37centigrade . Host： . Gene type:CRISPR . Prokaryotic resistance：Amp . Use：Gene knockout . Note: . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20ul ddH2O in to the tube of plasmid.

. Alias:No.155099 . Clone strain:Stbl3 . Culture conditions:37centigrade . Host：empty vector . Gene type:CRISPR,sgRNA . Prokaryotic resistance：Amp . Use：Gene knockout . Note: . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20ul ddH2O in to the tube of plasmid.

. Alias:No.85213 . Clone strain:Stbl3 . Culture conditions:37centigrade . Host：ORF . Gene type:Cre/Loxp . Prokaryotic resistance：Amp . Use：Gene knockout . Note: . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20ul ddH2O in to the tube of plasmid.

. Search name: Lenti dcas VP64-Blast,Plasmid Lenti dcas VP64-Blast,Lenti dcas VP64-Blast vector . Lenti dcas VP64-Blast Information . Plasmid type: CRISPR/Cas9 vector; gene knockout vector; mammalian vector . High copy / low copy: high copy . Cloning method: BsiWI, EcoRI . Promoter: EF1 . Carrier size: 14085 BP . 5'sequencing primers and sequences: GTTTGGATCTTGGTTCATTCTCAAGCCTCAG . 3'sequencing primers and sequences: cacatagcgtaaaaggagcaacatag . Carrier label: - . Vector resistance: ampicillin (Ampicilin) . Screening markers: Blasticidin . Cloned strain: Stbl3 . Host cells (lines): mammalian cells . Note: Mutation D10A and N863A in Cas9 . Stability: stable expression . Composition / inducible type: composition . Virus / non virus: slow disease . Use:CRISPR-CAS27-sgRNA plasmid

. lenti dCAS-VP64_Blast vector Information: . Product Name: lenti dCAS-VP64_Blast vector . Bacterial Resistance: Amp . Selectable markers: Blast . Growth Strain: Stbl3 . Growth Temperature: LB/37Centigrade degree

. lenti MS2-P65-HSF1_Hygro Information . Promoter: - . Replicator: pUC . Competent cells: Stbl3 . Culture temperature: 37 degrees . Plasmid host: Mammalian cells, lentivirus . Plasmid uses: Gene knockout, Mammal Editing plasmids . Prokaryotic resistance: Amp . Filter Tags: Hyg

. Lenti MS2-P65-HSF1_Neo PlasmidAlias: . Gene length: . Host: mammalian cells,Lentivirus . Use(s): gene editingFragment Type: CRISPR . Fragmented species: . Prokaryotic resistance: Amp . Screening Markers: Neo/G418 . Promoter: EF1a . replicon: pUC . Copy Number: . Competent cells: DH5a . Temperature: 37Degrees . Back Bones: . Forward primer: . Reverse primer:

. Function / . Resistance / . Screen / . Strain / . Culture temperature . Replicon . Copy . Promoter . Induction . Forward primer . Reverse primer

. Packing 2ug . Function / . Resistance Amp . Screen Zeo . Strain Stbl3 . Culture temperature LB/37

. Lenti-Cas9-Puro Information: . Use(s): Gene Editing . Prokaryotic resistance: Amp . Screening maker : Puro, Zero . Replicon: pUC . Competent cells : Stbl3 . Temperature: 37 degrees . Lenti-Cas9-Puro Description . Function Mammal Editing plasmids

. Search name: lenti-sgRNA-TagRFP-uspzz-1,Plasmid lenti-sgRNA-TagRFP-uspzz-1,lenti-sgRNA-TagRFP-uspzz-1 vector . Bacterial Resistance:Ampicillin . Growth Strain: . Species human(H. sapiens)

. Search name: lenti-sgRNA-TagRFP-uspzz-2,Plasmid lenti-sgRNA-TagRFP-uspzz-2,lenti-sgRNA-TagRFP-uspzz-2 vector . Bacterial Resistance:Ampicillin . Growth Strain: . Species human(H. sapiens)

. Search name: lenti-sgRNA-TagRFP-uspzz-3,Plasmid lenti-sgRNA-TagRFP-uspzz-3,lenti-sgRNA-TagRFP-uspzz-3 vector . Bacterial Resistance:Ampicillin . Growth Strain: . Species human(H. sapiens)

. Product Name:Lenti-(BB)-EF1a-KRAB-dCas9-P2A-EGFP . Promoter: EF1a,U6 . Prokaryotic resistance: Amp . Resistance Marker: EGFP . Host: mammalian cells . Vector type: Gene editing . Fragment type: . species: . Prokaryotic resistance: Amp . Resistance Marker: . Fluorescent labeling: Green fluorescence . For Lab research use only

. Alias:No.84750 . Clone strain:Stbl3 . Culture conditions:37centigrade . Host： . Gene type:CRISPR . Prokaryotic resistance：Amp . Use：Gene knockout . Note: . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20ul ddH2O in to the tube of plasmid.

. Lenti-dCas9-KRAB-blast Informaiton . Function Mammal Editing plasmids . Promoter: EF-1 alpha promoter . Terminator: WPRE . Plasmid size: 14229bp . Prokaryotic resistance: N-nucleoplasmin NLS, C-SV40 NLS . Screening marker: bleomycin Zeo, magnaporin Blast . Cloned strain: Escherichia coli Stbl3 . Culture conditions: 37℃, aerobic, LB . Lenti-dCas9-KRAB-blast Description Lenti-dCas9-KRAB-blast is a lentivirus overexpression plasmid, and the EF-1 alpha promoter drives the expression of the dCas9-KRAB protein fragment. It can be used in the gene editing experiment of mammalian cells. References to essential granules are: Multiplexed Engineering and Analysis of Combinatorial Enhancer Activity in Single Cells.

. lenti-EF1a-dCas9-KRAB-Puro vector Information: . Product Name: lenti-EF1a-dCas9-KRAB-Puro vector . Bacterial Resistance: Amp . Selectable markers: Puro . Growth Strain: Stbl3 . Growth Temperature: LB/37Centigrade degree . Copy number: High Copy . 5′ sequencing primer: GTTTGGATCTTGGTTCATTCTCAAGCCTCAG . 3′ sequencing primer: cacatagcgtaaaaggagcaacatag . Caution: Product is for research use only!

. Promoter: EF1a . Replicon: pUC . Prokaryotic resistance: Amp . Host: mammalian cells . Vector type: Gene editing . Fragment type: CRISPR . species: . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Promoter: EF1a . Replicon: pUC . Prokaryotic resistance: Amp . Host: lentiviral plasmid . Vector type: Transcriptional regulation . Fragment type: ncRNA . species: Human . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Promoter: EF1a . Replicon: pUC . Prokaryotic resistance: Amp . Host: lentiviral plasmid . Vector type: Transcriptional regulation . Fragment type: ncRNA . species: Human . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Lenti-EF1a-SLC5A5-FLAG-T2A-EGFP-PGK-Puro Information . Alternative name: NM_000453.3;NIS; TDH1 . Promoter: EF1a . Replicator: pUC . Clone strain: Stbl3 . Culture conditions: 37centigrade . Note: 1929bp . Lenti-EF1a-SLC5A5-FLAG-T2A-EGFP-PGK-Puro Description . Host: Mammalian cells,Lentivirus . Use: Protein expression . Species: . Gene type: ORF . Prokaryotic resistance: Amp . Eukaryotic resistance: Puro . Fluorescent protein: Green . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20ulddH2O in to the tube of plasmid. 3. (human);

. Promoter:Tet . Replicon:pUC . Competent cells:Stbl3 . Culture temperature:37 degrees . Host：Mammalian cells,Lentivirus . Plasmid use(s):Gene knockout . Fragment type：CRISPR . Fragment species： . Prokaryotic resistance：Amp . Selectable marker: Neo/G418 . Note: Plasmid 85400; . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.

. Alias:L-105621 . Promoter:EFS . Replicator:pUC . Clone strain:Stbl3 . Culture conditions:37centigrade . Host:mammalian cells,Lentivirus . Use:Protein expression . Species: . Gene type:ORF . Prokaryotic resistance:Amp . Eukaryotic resistance:G418 . Fluorescent protein:fLuc

. Lenti-SFFV-PPP2R2B-P2A-Puro PlasmidAlias:NM_181674.3;B55BETA; PP2AB55BETA; PP2ABBETA; PP2APR55B;PP2APR55BETA; PR2AB55BETA; PR2ABBETA; PR2APR55BETA; PR52B;PR55-BETA; PR55BETA; SCA12 . Gene length:1527bp . Host: mammalian cells,Lentivirus . Use(s): Protein expressionFragment Type: ORF . Fragmented species: Human . Prokaryotic resistance: Amp . Screening Markers: Puro . Green . Promoter: SFFV . replicon: pUC . Copy Number: . Competent cells: Stbl3 . Temperature: 37Degrees . Back Bones: . Forward primer: . Reverse primer:

. LentiCas9-EGFP Information: . Function Mammal Editing plasmids . Resistance Amp . Screen Zeo . Strain Stbl3 . Culture temperature 37degrees centigrade . Promoter: EF-1 alpha core promoter . Copier: Ori, F1 ori, SV40 ori . Terminator: WPRE . Plasmid classification: mammalian cell plasmid; mammalian editing plasmid; mammalian Cas9 plasmid . Plasmid size: 13177 BP . Plasmid tags: C-nucleoplasmin NLS, C-FLAG, C-EGFP . Prokaryotic resistance: ampicillin Amp . Screening Marker: Bleomycin Zeo . Cloning strain: Escherichia coli Stbl3 . Culture conditions: 37 C, aerobic, LB . Expressing host: mammalian cells such as 293T . LentiCas9-EGFP Description . Expresses human codon-optimized S. pyogenes Cas9 protein and EGFP from EFS promoter. 3rd generation lentiviral backbone. . LentiCas9-EGFP Reference . Genome-wide CRISPR screen in a mouse model of tumor growth and metastasis.

. Alternative Name: lentiCRISPR; lentiCRISPR V1 . Promoter: U6 . Replicator: pUC . Prokaryotic resistance: Amp . Filter marker: Puro . Clone strain: stbl3 . Culture condition: 37 ℃ . Vector host: mammalian cells, lentivirus . Application of vector: gene editing . Gene species: empty body . Gene type: CRISPR . Prokaryotic resistance: Amp . Eukaryotic resistance: Puro . Use:CRISPR-CAS23-sgRNA plasmid

. Promoter:U6 . Replicon:pUC . Competent cells:Stbl3 . Culture temperature:37 degrees . Host：Mammalian cells,Lentivirus . Plasmid use(s):Gene knockout . Fragment type：CRISPR,Cas9,sgRNA . Fragment species：empty vector . Prokaryotic resistance：Amp . Selectable marker: Blast . Note: Plasmid 83480; . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.

. Product Name:LentiCRISPR V2-control-sgRNA . Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Product Name:LentiCRISPR V2-CRACD-sgRNA1 . Replicon: pUC . Prokaryotic resistance: Amp . Resistance Marker: Puro . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Human . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Product Name:LentiCRISPR V2-CRACD-sgRNA3 . Replicon: pUC . Prokaryotic resistance: Amp . Resistance Marker: Puro . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Human . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Product Name:LentiCRISPR V2-DHODH-sgRNA2 . Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Human . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Product Name:LentiCRISPR V2-TRPC5-sgRNA2 . Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Mouse . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Product Name:LentiCRISPR V2-Trpv2-sgRNA1 . Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Mouse . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Product Name:LentiCRISPR V2-Trpv2-sgRNA2 . Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Mouse . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Plasmid type: Cas9 editing plasmids of mammalian cells . Cloned strain: Escherichia coli Stbl3 . Prokaryotic resistance: ampicillin Amp (100 u g/ml) . Screening markers: purinomycin Puro . Use:CRISPR-CAS24-sgRNA plasmid

. Product Name:LentiCRISPRv2 hygro . Promoter: U6 . Replicon: pUC . Prokaryotic resistance: Amp . Host: lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR . species: empty vector . Prokaryotic resistance: Amp . Resistance Marker: Hyg . Fluorescent labeling: . For Lab research use only

. Promoter U6 . Prokaryotic resistance Amp . Screening marker G418 . Clone strain Stbl3 . Culture Conditions LB/37 Celsius degree . Forward primer U6 . Reverse primer . lentiCRISPRv2 neo Plasmid Description . lentiCRISPRv2 neo Plasmid is a Lactation editing plasmid . NOTE: For research use only!

. Product Name:LentiCRISPRV2- Ano6-sgRNA1 . Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Mouse . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Mouse . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Mouse . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Product Name:LentiCRISPRV2-Ano1-sgRNA2 . Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Mouse . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Product Name:LentiCRISPRV2-Ano10-sgRNA1 . Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Mouse . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Mouse . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Human . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Human . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Mouse . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Mouse . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. LentiCRISPRV2-SQSTM1sgRNA1 PlasmidInformation . Promoter . Prokaryotic resistance Amp . Screening marker Puro . Clone strain DH5a . Culture Conditions LB/37 Celsius degree . Forward primer . Reverse primer . LentiCRISPRV2-SQSTM1sgRNA1 Plasmid Description . LentiCRISPRV2-SQSTM1sgRNA1 Plasmid is a RNA transcription plasmid . NOTE: For research use only!

. Promoter . Prokaryotic resistance Amp . Screening marker Puro . Clone strain DH5a . Culture Conditions LB/37 Celsius degree . Forward primer . Reverse primer . LentiCRISPRV2-SQSTM1sgRNA2 Plasmid Description . LentiCRISPRV2-SQSTM1sgRNA2 Plasmid is a RNA transcription plasmid . NOTE: For research use only!

. Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Mouse . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Mouse . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Mouse . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Mouse . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Mouse . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Mouse . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Mouse . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only