| Produkte |
|---|
|
PVT20759
Product name: LAMP1-RFP Tests/Size: Packing 2ug
Description: . Promoter: CMV
. Replicon: pUC
. Prokaryotic resistance: Kan
. Host: mammalian cells
. Vector type: Protein expression
. Fragment type: ORF
. species: Rat
. Prokaryotic resistance: Kan
. Resistance Marker: G418
. Fluorescent labeling: Red fluorescence
. For Lab research use only Quote Request:
Produktanfrage
|
|
PVT10424
Product name: LB1366 (BCL- 2 PROMOTER WITH MHS1234) Tests/Size: Packing 2ug
Description: . Function Promoter plasmid
. Resistance Amp
. Screen Hyg
. Strain DH5alpha
. Culture temperature 37degrees centigrade
. Replicon
. Copy
. Promoter
. Induction
. Forward primer
. Reverse primer Quote Request:
Produktanfrage
|
|
PVT10423
Product name: LB1376 (BCL- 2 P1 PROMOTER WITH MHS1234) Tests/Size: Packing 2ug
Description: . Function Promoter plasmid
. Resistance Amp
. Screen Hyg
. Strain DH5alpha
. Culture temperature 37degrees centigrade
. Replicon
. Copy
. Promoter
. Induction
. Forward primer
. Reverse primer Quote Request:
Produktanfrage
|
|
PVT10422
Product name: LB1377 (BCL- 2 P2 PROMOTER WITH MHS1234) Tests/Size: Packing 2ug
Description: . Function Promoter plasmid
. Resistance Amp
. Screen Hyg
. Strain DH5alpha
. Culture temperature 37degrees centigrade
. Replicon
. Copy
. Promoter
. Induction
. Forward primer
. Reverse primer Quote Request:
Produktanfrage
|
|
PVT36065
Product name: LBCPF1-2NLS Tests/Size: Packing 2ug
Description: . lias:No.102566
. Clone strain:Stbl3
. Culture conditions:37centigrade
. Host:
. Gene type:CRISPR
. Prokaryotic resistance:Amp
. Use:Gene knockout
. Note:
. Caution:
1. This product is FOR RESEARCH USE ONLY!
2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20ul ddH2O in to the tube of plasmid. Quote Request:
Produktanfrage
|
|
PVT39759
Product name: LCV2_MCLOVER3_AAVS1_SGRNA_2 Tests/Size: Packing 2ug
Description: . Alias:No.155099
. Clone strain:Stbl3
. Culture conditions:37centigrade
. Host:empty vector
. Gene type:CRISPR,sgRNA
. Prokaryotic resistance:Amp
. Use:Gene knockout
. Note:
. Caution:
1. This product is FOR RESEARCH USE ONLY!
2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20ul ddH2O in to the tube of plasmid. Quote Request:
Produktanfrage
|
|
PVT36725
Product name: LEGO-EBFP2 Tests/Size: Packing 2ug
Description: . Alias:No.85213
. Clone strain:Stbl3
. Culture conditions:37centigrade
. Host:ORF
. Gene type:Cre/Loxp
. Prokaryotic resistance:Amp
. Use:Gene knockout
. Note:
. Caution:
1. This product is FOR RESEARCH USE ONLY!
2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20ul ddH2O in to the tube of plasmid. Quote Request:
Produktanfrage
|
|
PVTY00599
Product name: LEGO-IC2 Tests/Size: Packing 2ug
Description: . LeGO-iC2 Description:
Plasmid type:Lentiviral vectorCopy Number:High copyCloning Method:Multiple cloning sites,restriction endonucleaseSize:7820 bp 5' Sequencing primers and sequences:GAGCTCACAACCCCTCACTCResistance(s):Ampicillin (Amp)Note:cloning strain is Stbl3 or TOP10
. Caution:
1. This product is FOR RESEARCH USE ONLY! Quote Request:
Produktanfrage
|
|
PVTY00200
Product name: LEGO-IG Tests/Size: Packing 2ug
Description: . LeGO-iG Description:
Plasmid type:Lentivirus expression Plasmid, RNAi vectorPromoter:SFFV, U6Size:8159 bp Resistance(s):AmpicillinReporter gene:EGFP
. Caution:
1. This product is FOR RESEARCH USE ONLY!
Quote Request:
Produktanfrage
|
|
PVTY00199
Product name: LEGO-Y Tests/Size: Packing 2ug
Description: . LeGO-Y Description
. Plasmid type:RNAi
. vectorPromoter:SFFV,
. U6Size:7467 bp
. Resistance(s):AmpicillinReporter
. gene:EYFP
. Caution:
1. This product is FOR RESEARCH USE ONLY!
Quote Request:
Produktanfrage
|
|
PVT6318
Product name: LENTI DCAS VP64- BLAST PLASMID Tests/Size: Packing 2ug
Description: . Search name: Lenti dcas VP64-Blast,Plasmid Lenti dcas VP64-Blast,Lenti dcas VP64-Blast vector
. Lenti dcas VP64-Blast Information
. Plasmid type: CRISPR/Cas9 vector; gene knockout vector; mammalian vector
. High copy / low copy: high copy
. Cloning method: BsiWI, EcoRI
. Promoter: EF1
. Carrier size: 14085 BP
. 5'sequencing primers and sequences: GTTTGGATCTTGGTTCATTCTCAAGCCTCAG
. 3'sequencing primers and sequences: cacatagcgtaaaaggagcaacatag
. Carrier label: -
. Vector resistance: ampicillin (Ampicilin)
. Screening markers: Blasticidin
. Cloned strain: Stbl3
. Host cells (lines): mammalian cells
. Note: Mutation D10A and N863A in Cas9
. Stability: stable expression
. Composition / inducible type: composition
. Virus / non virus: slow disease
. Use:CRISPR-CAS27-sgRNA plasmid
Quote Request:
Produktanfrage
|
|
PVTY00188
Product name: LENTI DCAS-VP64_BLAST Tests/Size: Packing 2ug
Description: . lenti dCAS-VP64_Blast Description
. Plasmid type: Lentiviral expression vector,CRISPR-Cas9 system
. Promoter: EF1a
. Size: 14085 bp
. Resistance(s): Ampicillin
. Selectable markers: Blasticidin
. Note: 3rd generation lenti vector encoding dCAS9-VP64 with 2A Blast resistance marker (EF1a-NLS-dCas9(N863)-VP64-2A-Blast-WPRE)
Quote Request:
Produktanfrage
|
|
PVT12113
Product name: LENTI DCAS-VP64_BLAST VECTOR Tests/Size: Packing 2ug
Description: . lenti dCAS-VP64_Blast vector Information:
. Product Name: lenti dCAS-VP64_Blast vector
. Bacterial Resistance: Amp
. Selectable markers: Blast
. Growth Strain: Stbl3
. Growth Temperature: LB/37Centigrade degree
Quote Request:
Produktanfrage
|
|
PVT10995
Product name: LENTI MS2- P65- HSF1_HYGRO Tests/Size: Packing 2ug
Description: . lenti MS2-P65-HSF1_Hygro Information
. Promoter: -
. Replicator: pUC
. Competent cells: Stbl3
. Culture temperature: 37 degrees
. Plasmid host: Mammalian cells, lentivirus
. Plasmid uses: Gene knockout, Mammal Editing plasmids
. Prokaryotic resistance: Amp
. Filter Tags: Hyg
Quote Request:
Produktanfrage
|
|
PVT49504
Product name: LENTI MS2-P65-HSF1_NEO PLASMID Tests/Size: Packing 2ug
Description: . Lenti MS2-P65-HSF1_Neo PlasmidAlias:
. Gene length:
. Host: mammalian cells,Lentivirus
. Use(s): gene editingFragment Type: CRISPR
. Fragmented species:
. Prokaryotic resistance: Amp
. Screening Markers: Neo/G418
. Promoter: EF1a
. replicon: pUC
. Copy Number:
. Competent cells: DH5a
. Temperature: 37Degrees
. Back Bones:
. Forward primer:
. Reverse primer:
Quote Request:
Produktanfrage
|
|
PVT11345
Product name: LENTI SGRNA (MS2)_PURO BACKBONE Tests/Size: Packing 2ug
Description: . Function /
. Resistance /
. Screen /
. Strain /
. Culture temperature
. Replicon
. Copy
. Promoter
. Induction
. Forward primer
. Reverse primer
Quote Request:
Produktanfrage
|
|
PVT11344
Product name: LENTI SGRNA (MS2)_ZEO BACKBONE Tests/Size: Packing 2ug
Description: . Packing 2ug
. Function /
. Resistance Amp
. Screen Zeo
. Strain Stbl3
. Culture temperature LB/37
Quote Request:
Produktanfrage
|
|
PVT10981
Product name: LENTI- CAS9- PURO Tests/Size: Packing 2ug
Description: . Lenti-Cas9-Puro Information:
. Use(s): Gene Editing
. Prokaryotic resistance: Amp
. Screening maker : Puro, Zero
. Replicon: pUC
. Competent cells : Stbl3
. Temperature: 37 degrees
. Lenti-Cas9-Puro Description
. Function Mammal Editing plasmids
Quote Request:
Produktanfrage
|
|
PVT7230
Product name: LENTI- SGRNA- TAGRFP- USPZZ- 1 PLASMID Tests/Size: Packing 2ug
Description: . Search name: lenti-sgRNA-TagRFP-uspzz-1,Plasmid lenti-sgRNA-TagRFP-uspzz-1,lenti-sgRNA-TagRFP-uspzz-1 vector
. Bacterial Resistance:Ampicillin
. Growth Strain:
. Species human(H. sapiens) Quote Request:
Produktanfrage
|
|
PVT7231
Product name: LENTI- SGRNA- TAGRFP- USPZZ- 2 PLASMID Tests/Size: Packing 2ug
Description: . Search name: lenti-sgRNA-TagRFP-uspzz-2,Plasmid lenti-sgRNA-TagRFP-uspzz-2,lenti-sgRNA-TagRFP-uspzz-2 vector
. Bacterial Resistance:Ampicillin
. Growth Strain:
. Species human(H. sapiens) Quote Request:
Produktanfrage
|
|
PVT7232
Product name: LENTI- SGRNA- TAGRFP- USPZZ- 3 PLASMID Tests/Size: Packing 2ug
Description: . Search name: lenti-sgRNA-TagRFP-uspzz-3,Plasmid lenti-sgRNA-TagRFP-uspzz-3,lenti-sgRNA-TagRFP-uspzz-3 vector
. Bacterial Resistance:Ampicillin
. Growth Strain:
. Species human(H. sapiens) Quote Request:
Produktanfrage
|
|
PVT19836
Product name: LENTI-(BB)-EF1A-KRAB-DCAS9-P2A-EGFP Tests/Size: Packing 2ug
Description: . Product Name:Lenti-(BB)-EF1a-KRAB-dCas9-P2A-EGFP
. Promoter: EF1a,U6
. Prokaryotic resistance: Amp
. Resistance Marker: EGFP
. Host: mammalian cells
. Vector type: Gene editing
. Fragment type:
. species:
. Prokaryotic resistance: Amp
. Resistance Marker:
. Fluorescent labeling: Green fluorescence
. For Lab research use only Quote Request:
Produktanfrage
|
|
PVT36500
Product name: LENTI-ASCPF1-BLAST Tests/Size: Packing 2ug
Description: . Alias:No.84750
. Clone strain:Stbl3
. Culture conditions:37centigrade
. Host:
. Gene type:CRISPR
. Prokaryotic resistance:Amp
. Use:Gene knockout
. Note:
. Caution:
1. This product is FOR RESEARCH USE ONLY!
2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20ul ddH2O in to the tube of plasmid. Quote Request:
Produktanfrage
|
|
PVT10919
Product name: LENTI-DCAS9-KRAB-BLAST Tests/Size: Packing 2ug
Description: . Lenti-dCas9-KRAB-blast Informaiton
. Function Mammal Editing plasmids
. Promoter: EF-1 alpha promoter
. Terminator: WPRE
. Plasmid size: 14229bp
. Prokaryotic resistance: N-nucleoplasmin NLS, C-SV40 NLS
. Screening marker: bleomycin Zeo, magnaporin Blast
. Cloned strain: Escherichia coli Stbl3
. Culture conditions: 37℃, aerobic, LB
. Lenti-dCas9-KRAB-blast Description
Lenti-dCas9-KRAB-blast is a lentivirus overexpression plasmid, and the EF-1 alpha promoter drives the expression of the dCas9-KRAB protein fragment. It can be used in the gene editing experiment of mammalian cells. References to essential granules are: Multiplexed Engineering and Analysis of Combinatorial Enhancer Activity in Single Cells. Quote Request:
Produktanfrage
|
|
PVT12069
Product name: LENTI-EF1A-DCAS9-KRAB-PURO VECTOR Tests/Size: Packing 2ug
Description: . lenti-EF1a-dCas9-KRAB-Puro vector Information:
. Product Name: lenti-EF1a-dCas9-KRAB-Puro vector
. Bacterial Resistance: Amp
. Selectable markers: Puro
. Growth Strain: Stbl3
. Growth Temperature: LB/37Centigrade degree
. Copy number: High Copy
. 5′ sequencing primer: GTTTGGATCTTGGTTCATTCTCAAGCCTCAG
. 3′ sequencing primer: cacatagcgtaaaaggagcaacatag
. Caution:
Product is for research use only! Quote Request:
Produktanfrage
|
|
PVT20093
Product name: LENTI-EF1A-DCAS9-VPR-PURO Tests/Size: Packing 2ug
Description: . Promoter: EF1a
. Replicon: pUC
. Prokaryotic resistance: Amp
. Host: mammalian cells
. Vector type: Gene editing
. Fragment type: CRISPR
. species:
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only Quote Request:
Produktanfrage
|
|
PVT20009
Product name: LENTI-EF1A-LINC00595-DELTA383-426-PURO Tests/Size: Packing 2ug
Description: . Promoter: EF1a
. Replicon: pUC
. Prokaryotic resistance: Amp
. Host: lentiviral plasmid
. Vector type: Transcriptional regulation
. Fragment type: ncRNA
. species: Human
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only Quote Request:
Produktanfrage
|
|
PVT20037
Product name: LENTI-EF1A-LINC00595-DELTA588-624-PURO Tests/Size: Packing 2ug
Description: . Promoter: EF1a
. Replicon: pUC
. Prokaryotic resistance: Amp
. Host: lentiviral plasmid
. Vector type: Transcriptional regulation
. Fragment type: ncRNA
. species: Human
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only
Quote Request:
Produktanfrage
|
|
PVT28136
Product name: LENTI-EF1A-SLC5A5-FLAG-T2A-EGFP-PGK-PURO Tests/Size: Packing 2ug
Description: . Lenti-EF1a-SLC5A5-FLAG-T2A-EGFP-PGK-Puro Information
. Alternative name: NM_000453.3;NIS; TDH1
. Promoter: EF1a
. Replicator: pUC
. Clone strain: Stbl3
. Culture conditions: 37centigrade
. Note: 1929bp
. Lenti-EF1a-SLC5A5-FLAG-T2A-EGFP-PGK-Puro Description
. Host: Mammalian cells,Lentivirus
. Use: Protein expression
. Species:
. Gene type: ORF
. Prokaryotic resistance: Amp
. Eukaryotic resistance: Puro
. Fluorescent protein: Green
. Caution:
1. This product is FOR RESEARCH USE ONLY!
2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20ulddH2O in to the tube of plasmid.
3. (human);
Quote Request:
Produktanfrage
|
|
PVT46534
Product name: LENTI-ICAS9-NEO PLASMID Tests/Size: Packing 2ug
Description: . Promoter:Tet
. Replicon:pUC
. Competent cells:Stbl3
. Culture temperature:37 degrees
. Host:Mammalian cells,Lentivirus
. Plasmid use(s):Gene knockout
. Fragment type:CRISPR
. Fragment species:
. Prokaryotic resistance:Amp
. Selectable marker: Neo/G418
. Note: Plasmid 85400;
. Caution:
1. This product is FOR RESEARCH USE ONLY!
2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.
Quote Request:
Produktanfrage
|
|
PVT32797
Product name: LENTI-LUCIFERASE-P2A-NEO Tests/Size: Packing 2ug
Description: . Alias:L-105621
. Promoter:EFS
. Replicator:pUC
. Clone strain:Stbl3
. Culture conditions:37centigrade
. Host:mammalian cells,Lentivirus
. Use:Protein expression
. Species:
. Gene type:ORF
. Prokaryotic resistance:Amp
. Eukaryotic resistance:G418
. Fluorescent protein:fLuc
Quote Request:
Produktanfrage
|
|
PVT51011
Product name: LENTI-SFFV-PPP2R2B-P2A-PURO PLASMID Tests/Size: Packing 2ug
Description: . Lenti-SFFV-PPP2R2B-P2A-Puro PlasmidAlias:NM_181674.3;B55BETA; PP2AB55BETA; PP2ABBETA; PP2APR55B;PP2APR55BETA; PR2AB55BETA; PR2ABBETA; PR2APR55BETA; PR52B;PR55-BETA; PR55BETA; SCA12
. Gene length:1527bp
. Host: mammalian cells,Lentivirus
. Use(s): Protein expressionFragment Type: ORF
. Fragmented species: Human
. Prokaryotic resistance: Amp
. Screening Markers: Puro
. Green
. Promoter: SFFV
. replicon: pUC
. Copy Number:
. Competent cells: Stbl3
. Temperature: 37Degrees
. Back Bones:
. Forward primer:
. Reverse primer:
Quote Request:
Produktanfrage
|
|
PVT10979
Product name: LENTICAS9- EGFP Tests/Size: Packing 2ug
Description: . LentiCas9-EGFP Information:
. Function Mammal Editing plasmids
. Resistance Amp
. Screen Zeo
. Strain Stbl3
. Culture temperature 37degrees centigrade
. Promoter: EF-1 alpha core promoter
. Copier: Ori, F1 ori, SV40 ori
. Terminator: WPRE
. Plasmid classification: mammalian cell plasmid; mammalian editing plasmid; mammalian Cas9 plasmid
. Plasmid size: 13177 BP
. Plasmid tags: C-nucleoplasmin NLS, C-FLAG, C-EGFP
. Prokaryotic resistance: ampicillin Amp
. Screening Marker: Bleomycin Zeo
. Cloning strain: Escherichia coli Stbl3
. Culture conditions: 37 C, aerobic, LB
. Expressing host: mammalian cells such as 293T
. LentiCas9-EGFP Description
. Expresses human codon-optimized S. pyogenes Cas9 protein and EGFP from EFS promoter. 3rd generation lentiviral backbone.
. LentiCas9-EGFP Reference
. Genome-wide CRISPR screen in a mouse model of tumor growth and metastasis. Quote Request:
Produktanfrage
|
|
PVTY00170
Product name: LENTICAS9-BLAST Tests/Size: Packing 2ug
Description: . lentiCas9-Blast Description
. Plasmid type:Lentiviral vector
. There are currently no product reviews. Quote Request:
Produktanfrage
|
|
PVT6314
Product name: LENTICRISPR V1.0 Tests/Size: Packing 2ug
Description: . Alternative Name: lentiCRISPR; lentiCRISPR V1
. Promoter: U6
. Replicator: pUC
. Prokaryotic resistance: Amp
. Filter marker: Puro
. Clone strain: stbl3
. Culture condition: 37 ℃
. Vector host: mammalian cells, lentivirus
. Application of vector: gene editing
. Gene species: empty body
. Gene type: CRISPR
. Prokaryotic resistance: Amp
. Eukaryotic resistance: Puro
. Use:CRISPR-CAS23-sgRNA plasmid Quote Request:
Produktanfrage
|
|
PVTY00143
Product name: LENTICRISPR V2 Tests/Size: Packing 2ug
Description: . Plasmid type:CRISPR-Cas9
. systemSize:14873 bp
. Resistance(s):AmpicillinSelectable
. markers:Puromycin
. Caution:
1. This product is FOR RESEARCH USE ONLY! Quote Request:
Produktanfrage
|
|
PVT40201
Product name: LENTICRISPR V2-BLAST PLASMID Tests/Size: Packing 2ug
Description: . Promoter:U6
. Replicon:pUC
. Competent cells:Stbl3
. Culture temperature:37 degrees
. Host:Mammalian cells,Lentivirus
. Plasmid use(s):Gene knockout
. Fragment type:CRISPR,Cas9,sgRNA
. Fragment species:empty vector
. Prokaryotic resistance:Amp
. Selectable marker: Blast
. Note: Plasmid 83480;
. Caution:
1. This product is FOR RESEARCH USE ONLY!
2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid. Quote Request:
Produktanfrage
|
|
PVT24225
Product name: LENTICRISPR V2-CONTROL-SGRNA Tests/Size: Packing 2ug
Description: . Product Name:LentiCRISPR V2-control-sgRNA
. Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species:
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only Quote Request:
Produktanfrage
|
|
PVT23084
Product name: LENTICRISPR V2-CRACD-SGRNA1 Tests/Size: Packing 2ug
Description: . Product Name:LentiCRISPR V2-CRACD-sgRNA1
. Replicon: pUC
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Human
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only Quote Request:
Produktanfrage
|
|
PVT23087
Product name: LENTICRISPR V2-CRACD-SGRNA3 Tests/Size: Packing 2ug
Description: . Product Name:LentiCRISPR V2-CRACD-sgRNA3
. Replicon: pUC
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Human
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only Quote Request:
Produktanfrage
|
|
PVT23634
Product name: LENTICRISPR V2-DHODH-SGRNA2 Tests/Size: Packing 2ug
Description: . Product Name:LentiCRISPR V2-DHODH-sgRNA2
. Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Human
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only Quote Request:
Produktanfrage
|
|
PVT24222
Product name: LENTICRISPR V2-TRPC5-SGRNA2 Tests/Size: Packing 2ug
Description: . Product Name:LentiCRISPR V2-TRPC5-sgRNA2
. Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Mouse
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only Quote Request:
Produktanfrage
|
|
PVT24224
Product name: LENTICRISPR V2-TRPV2-SGRNA1 Tests/Size: Packing 2ug
Description: . Product Name:LentiCRISPR V2-Trpv2-sgRNA1
. Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Mouse
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only Quote Request:
Produktanfrage
|
|
PVT24223
Product name: LENTICRISPR V2-TRPV2-SGRNA2 Tests/Size: Packing 2ug
Description: . Product Name:LentiCRISPR V2-Trpv2-sgRNA2
. Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Mouse
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only Quote Request:
Produktanfrage
|
|
PVT6315
Product name: LENTICRISPR V2.0 Tests/Size: Packing 2ug
Description: . Plasmid type: Cas9 editing plasmids of mammalian cells
. Cloned strain: Escherichia coli Stbl3
. Prokaryotic resistance: ampicillin Amp (100 u g/ml)
. Screening markers: purinomycin Puro
. Use:CRISPR-CAS24-sgRNA plasmid Quote Request:
Produktanfrage
|
|
PVT20751
Product name: LENTICRISPRV2 HYGRO Tests/Size: Packing 2ug
Description: . Product Name:LentiCRISPRv2 hygro
. Promoter: U6
. Replicon: pUC
. Prokaryotic resistance: Amp
. Host: lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR
. species: empty vector
. Prokaryotic resistance: Amp
. Resistance Marker: Hyg
. Fluorescent labeling:
. For Lab research use only Quote Request:
Produktanfrage
|
|
PVT17089
Product name: LENTICRISPRV2 NEO PLASMID Tests/Size: Packing 2ug
Description: . Promoter U6
. Prokaryotic resistance Amp
. Screening marker G418
. Clone strain Stbl3
. Culture Conditions LB/37 Celsius degree
. Forward primer U6
. Reverse primer
. lentiCRISPRv2 neo Plasmid Description
. lentiCRISPRv2 neo Plasmid is a Lactation editing plasmid
. NOTE: For research use only! Quote Request:
Produktanfrage
|
|
PVT25768
Product name: LENTICRISPRV2- ANO6-SGRNA1 Tests/Size: Packing 2ug
Description: . Product Name:LentiCRISPRV2- Ano6-sgRNA1
. Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Mouse
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only Quote Request:
Produktanfrage
|
|
PVT25767
Product name: LENTICRISPRV2- ANO6-SGRNA2 Tests/Size: Packing 2ug
Description: . Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Mouse
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only Quote Request:
Produktanfrage
|
|
PVT25785
Product name: LENTICRISPRV2-ANO1-SGRNA1 Tests/Size: Packing 2ug
Description: . Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Mouse
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only Quote Request:
Produktanfrage
|
|
PVT25783
Product name: LENTICRISPRV2-ANO1-SGRNA2 Tests/Size: Packing 2ug
Description: . Product Name:LentiCRISPRV2-Ano1-sgRNA2
. Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Mouse
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only Quote Request:
Produktanfrage
|
|
PVT25786
Product name: LENTICRISPRV2-ANO10-SGRNA1 Tests/Size: Packing 2ug
Description: . Product Name:LentiCRISPRV2-Ano10-sgRNA1
. Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Mouse
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only Quote Request:
Produktanfrage
|
|
PVT25780
Product name: LENTICRISPRV2-ANO10-SGRNA2 Tests/Size: Packing 2ug
Description: . Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Mouse
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only Quote Request:
Produktanfrage
|
|
PVT25605
Product name: LENTICRISPRV2-CRACD-SGRNA2 Tests/Size: Packing 2ug
Description: . Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Human
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only Quote Request:
Produktanfrage
|
|
PVT25784
Product name: LENTICRISPRV2-DHODH-SGRNA1 Tests/Size: Packing 2ug
Description: . Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Human
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only Quote Request:
Produktanfrage
|
|
PVT25782
Product name: LENTICRISPRV2-KCNH2-SGRNA1 Tests/Size: Packing 2ug
Description: . Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Mouse
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only Quote Request:
Produktanfrage
|
|
PVT25781
Product name: LENTICRISPRV2-KCNH2-SGRNA2 Tests/Size: Packing 2ug
Description: . Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Mouse
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only Quote Request:
Produktanfrage
|
|
PVT15983
Product name: LENTICRISPRV2-SQSTM1SGRNA1 PLASMID Tests/Size: Packing 2ug
Description: . LentiCRISPRV2-SQSTM1sgRNA1 PlasmidInformation
. Promoter
. Prokaryotic resistance Amp
. Screening marker Puro
. Clone strain DH5a
. Culture Conditions LB/37 Celsius degree
. Forward primer
. Reverse primer
. LentiCRISPRV2-SQSTM1sgRNA1 Plasmid Description
. LentiCRISPRV2-SQSTM1sgRNA1 Plasmid is a RNA transcription plasmid
. NOTE: For research use only! Quote Request:
Produktanfrage
|
|
PVT15944
Product name: LENTICRISPRV2-SQSTM1SGRNA2 PLASMID Tests/Size: Packing 2ug
Description: . Promoter
. Prokaryotic resistance Amp
. Screening marker Puro
. Clone strain DH5a
. Culture Conditions LB/37 Celsius degree
. Forward primer
. Reverse primer
. LentiCRISPRV2-SQSTM1sgRNA2 Plasmid Description
. LentiCRISPRV2-SQSTM1sgRNA2 Plasmid is a RNA transcription plasmid
. NOTE: For research use only! Quote Request:
Produktanfrage
|
|
PVT25770
Product name: LENTICRISPRV2-TRPC1-SGRNA1 Tests/Size: Packing 2ug
Description: . Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Mouse
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only Quote Request:
Produktanfrage
|
|
PVT25769
Product name: LENTICRISPRV2-TRPC1-SGRNA2 Tests/Size: Packing 2ug
Description: . Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Mouse
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only
Quote Request:
Produktanfrage
|
|
PVT25787
Product name: LENTICRISPRV2-TRPC5-SGRNA1 Tests/Size: Packing 2ug
Description: . Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Mouse
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only
Quote Request:
Produktanfrage
|
|
PVT25458
Product name: LENTICRISPRV2-TRPC6-SGRNA1 Tests/Size: Packing 2ug
Description: . Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Mouse
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only
Quote Request:
Produktanfrage
|
|
PVT25773
Product name: LENTICRISPRV2-TRPC6-SGRNA2 Tests/Size: Packing 2ug
Description: . Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Mouse
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only Quote Request:
Produktanfrage
|
|
PVT25772
Product name: LENTICRISPRV2-TRPM2-SGRNA1 Tests/Size: Packing 2ug
Description: . Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Mouse
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only Quote Request:
Produktanfrage
|
|
PVT25771
Product name: LENTICRISPRV2-TRPM2-SGRNA2 Tests/Size: Packing 2ug
Description: . Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Mouse
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only Quote Request:
Produktanfrage
|
|
LIO-Feron 02_22
Product name: HUMAN IFN-Y - LIOFeron Tests/Size: ELISA 22T Description: Der LIOFeron®TB/LTBI ist ein Zytokin-Freisetzungstest zur quantitativen Bestimmung von Interferon Gamma (IFN-γ), das von menschlichen Blutzellen produziert wird, die mit Mycobacterium tuberculosis Antigenen stimuliert wurden. Daher ist der Test für die Diagnose einer latenten TB-Infektion (LTBI) geeignet. Wie andere IGRA-Tests auf dem Markt kann auch dieser Test bei TB-Patienten positiv reagieren, kann aber nicht zwischen LTBI und aktiver TB unterscheiden.
AnleitungenQuote Request:
Produktanfrage
|
