. Product Name: ER2738 vector . Bacterial Resistance: Tet . Selectable markers: / . Growth Strain: . Growth Temperature: LB/37Centigrade degree

. Promoter: U6 . Replicon: pUC . Prokaryotic resistance: Amp . Host: mammalian cells . Vector type: Gene editing . Fragment type: CRISPR . species: empty vector . Prokaryotic resistance: Amp . Resistance Marker: . Fluorescent labeling: . For Lab research use only

. ERroGFP_iE_pCDNA3 Alternative name ERroGFP_iE_pCDNA3ERroGFP_iE_pCDNA3 vector, ERroGFP_iE_pCDNA3 plasmid, ERroGFP_iE_pCDNA3 map, . . . . . . . ERroGFP_iE_pCDNA3 sequence, . Promoter - . Replicon - . Terminator - . Resistance - . Strain - . Culture conditions - . Forward primer - . Reverse primer -

. eSpCas9(1.1) Information . Function Mammal Editing plasmids . Prokaryotic resistance: ampicillin Amp . Cloned strain: Escherichia coli Stbl3 . Culture conditions: 37 centigrade, LB medium . eSpCas9(1.1) Desccription: . ESpCas9 (1.1) is a mammalian gene editing plasmid

. EZ-guideXH Search name: EZ-guideXH,EZ-guideXH vector,EZ-guideXH plasmid,EZ-guideXH map . EZ-guideXH Information . Bacterial Resistance(s): Amp . Screening: . Growth Strain(s): DH5 alpha . Growth Condition: LB/37 Centigrade . EZ-guideXH Description . EZ-GuideXH is generated based on EZ-T cloning vector. The main purpose of this plasmid is for preparation of the second guide RNA.

. Promoter: 10B2 . Replicon: pUC . Growth Strain(s): DH5a . Host: Yeast . Vector type: . Fragment type: . species: . Prokaryotic resistance: Amp . Resistance Marker: URA3 . Fluorescent labeling: Red fluorescence . For Lab research use only

. FH-TET1-pEF Plasmid Desciption . Promoter:EF1a . Replicon:pUC . Competent cells:DH5a . Culture temperature:37 degrees . Host：Mammalian cells . Plasmid use(s):Protein expression . Fragment type：ORF . Fragment species：Human . Prokaryotic resistance：Amp . Selectable marker: Neo/G418 . Note: Plasmid 49792; . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.

. Promoter: FHRE . Replicon: pUC . Prokaryotic resistance: Amp . Host: mammalian cells . Vector type: signal report . Fragment type: Promoter . species: Human . Prokaryotic resistance: Amp . Resistance Marker: . Fluorescent labeling: Fluc . For Lab research use only

. Flag Depdc5 pRK5 PlasmidAlias:Plasmid#46340 . Gene length:4746bp . Host: mammalian cells . Use(s): Protein expressionFragment Type: ORF . Fragmented species: Human . Prokaryotic resistance: Amp . Screening Markers: . Promoter: CMV . replicon: pUC . Copy Number: . Competent cells: DH5a . Temperature: 37Degrees . Back Bones: . Forward primer:CMV-F . Reverse primer: . Induction method:

. Host: mammalian cells . Use(s): Protein expressionFragment Type: ORF . Fragmented species: Mouse . Prokaryotic resistance: Amp . Screening Markers: Neo/G418 . Promoter: CMV . replicon: pUC . Copy Number: . Competent cells: DH5a . Temperature: 37Degrees . Back Bones: . Forward primer:CMV-F . Reverse primer: . Induction method:

. Alternative Name: FLAG-HA-CYLD,FLAG-HA-CYLD vector,FLAG-HA-CYLD plasmid,FLAG-HA-CYLD map,FLAG-HA-CYLD sequence . Plasmid form: Freeze-dried powder . Storage Condition: -20 Centigrade . Promoter: inquiry . Bacterial Resistance(s): Amp . Screening: inquiry . Growth Strain(s): DH5alpha . Culture Medium: LB . Temperature: 37 Centigrade

. Promoter: CMV . Replicon: pUC . Prokaryotic resistance: Amp . Host: Retroviral . Vector type: Protein expression . Fragment type: ORF . species: Human . Prokaryotic resistance: Amp . Resistance Marker: Puro . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.Take 2ul plasmid into 100 μ L corresponding competent cell, centrifugal then full coating on plate. 3. Shipping temperature is 2-8℃.

. Promoter: CMV . Replicon: pUC . Prokaryotic resistance: Amp . Host: mammalian cells . Vector type: Protein expression . Fragment type: ORF . species: Human . Prokaryotic resistance: Amp . Resistance Marker: . Fluorescent labeling: . For Lab research use only

. Promoter: CMV . Replicon: pUC . Growth Strain(s): DH5a . Host: mammalian cells . Vector type: Protein expression . Fragment type: ORF . species: Human . Prokaryotic resistance: Amp . Resistance Marker: . Fluorescent labeling: . For Lab research use only

. Function ORF expression plasmid . Resistance Amp . Screen / . Strain DH5alpha . Culture temperature 37degrees centigrade . Replicon . Copy . Promoter . Induction . Forward primer . Reverse primer

. Replicon: pUC ori replicon . Plasmid classification: cDNA gene bank . Clone strain: Escherichia coli DH5 alpha . Culture conditions: 37 LB, medium. . Species human(H. sapiens)

. Growing strain: Stbl3 . Culture conditions: 37℃ . Plasmid host: Mammalian cells . Uses: Interference silence . Segment type: CRISPR,Cas9 . Prokaryotic resistance: Amp . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.

. Search name: Fop-Flash,Plasmid Fop-Flash,Fop-Flash vector . Fop-Flash Information . Promoter: TK . Replicon: pUC ori . Terminator: SV40 poly (A) signal . Plasmid classification: mammalian cells, signal pathway reporting vectors . Prokaryotic resistance: ampicillin Amp . Cloned strain: Escherichia coli DH5 alpha . Culture conditions: 37 centigrade, aerobic, LB . Expression host: mammalian cells . 5'sequencing primers: primers designed according to sequence . 3'sequencing primers: primers designed according to sequence

. Function Mammal reporter plasmid . Resistance Amp . Screen / . Strain DH5alpha . Culture temperature 37degrees centigrade . Replicon pUC . Copy . Promoter TK . Induction -- . Forward primer . Reverse primer

. Alternative Name: FRB-NLuc,FRB-NLuc vector,FRB-NLuc plasmid,FRB-NLuc map,FRB-NLuc sequence . Plasmid form: Freeze-dried powder . Storage Condition: -20 Centigrade . Bulk order Please contact us: sales@lifescience-market.com . Promoter: CMV . Bacterial Resistance(s): Amp . Screening: G418 . Growth Strain(s): DH5alpha . Culture Medium: LB . Temperature: 37 Centigrade . Vector Size: 1608bp . Product is for research use only!

. Function ORF expression plasmid . Resistance Amp . Screen / . Strain Stbl3 . Culture temperature 37degrees centigrade . Replicon . Copy . Promoter . Induction . Forward primer . Reverse primer

. Promoter:UBC . Replicon:pUC . Competent cells:Stbl3 . Culture temperature:37 degrees . Host：Mammalian cells,Lentivirus . Plasmid use(s):Protein expression . Fragment type：ORF . Fragment species： . Prokaryotic resistance：Amp . Selectable marker: . Note: Plasmid 19780; . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.

. Function / . Resistance Amp . Screen / . Strain Stbl3 . Culture temperature 37degrees centigrade . Replicon . Copy . Promoter . Induction . Forward primer . Reverse primer

. Fuw-dCas9-Dnmt3a_IM Alternative name: Fuw-dCas9-Dnmt3a_IMFuw-dCas9-Dnmt3a_IM vector, Fuw-dCas9-Dnmt3a_IM plasmid, Fuw-dCas9-Dnmt3a_IM map, Fuw-dCas9-Dnmt3a_IM sequence, . Promoter - . Replicon - . Terminator - . Resistance - . Strain - . Culture conditions - . Forward primer - . Reverse primer -

. Search name: FUW-M2rtTA (Plasmid #20342),Plasmid FUW-M2rtTA (Plasmid #20342),FUW-M2rtTA (Plasmid #20342) vector . Bacterial Resistance:Ampicillin . Growth Strain: . Species human(H. sapiens)

. Function ORF expression plasmid . Resistance Amp . Screen / . Strain DH5alpha . Culture temperature 37degrees centigrade . Replicon . Copy . Promoter . Induction . Forward primer . Reverse primer

. Function ORF expression plasmid . Resistance Amp . Screen / . Strain DH5alpha . Culture temperature 37degrees centigrade . Replicon . Copy . Promoter . Induction . Forward primer . Reverse primer

. Function ORF expression plasmid . Resistance Amp . Screen / . Strain DH5alpha . Culture temperature 37degrees centigrade . Replicon . Copy . Promoter . Induction . Forward primer . Reverse primer

. Function ORF expression plasmid . Resistance Amp . Screen / . Strain DH5alpha . Culture temperature 37degrees centigrade . Replicon . Copy . Promoter . Induction . Forward primer . Reverse primer

. Search name: FUW-TetracycliNeomycin-hKLF4 (Plasmid #20725),Plasmid FUW-TetracycliNeomycin-hKLF4 (Plasmid #20725),FUW-TetracycliNeomycin-hKLF4 (Plasmid #20725) vector . Bacterial Resistance:Ampicillin . Growth Strain: . Species human(H. sapiens)

. Search name: FUW-TetracycliNeomycin-hMYC (Plasmid #20723),Plasmid FUW-TetracycliNeomycin-hMYC (Plasmid #20723),FUW-TetracycliNeomycin-hMYC (Plasmid #20723) vector . Bacterial Resistance:Ampicillin . Growth Strain: . Species human(H. sapiens)

. Search name: FUW-TetracycliNeomycin-hOCT4 (Plasmid #20726),Plasmid FUW-TetracycliNeomycin-hOCT4 (Plasmid #20726),FUW-TetracycliNeomycin-hOCT4 (Plasmid #20726) vector . Bacterial Resistance:Ampicillin . Growth Strain: . Species human(H. sapiens)

. Search name: FUW-TetracycliNeomycin-hSOX2 (Plasmid #20724),Plasmid FUW-TetracycliNeomycin-hSOX2 (Plasmid #20724),FUW-TetracycliNeomycin-hSOX2 (Plasmid #20724) vector Bacterial Resistance:Ampicillin . Growth Strain: . Species human(H. sapiens)

. Promoter: Ubc . Replicon: pUC . Prokaryotic resistance: Amp . Host: mammalian cells,lentiviral plasmid . Vector type: gene silencing . Fragment type: CRISPR,Cas9 . species: Human . Prokaryotic resistance: Amp . Resistance Marker: . Fluorescent labeling: . For Lab research use only

. Promoter: Tet . Prokaryotic resistance: Amp . Resistance Marker: Puro . Host: lentiviral plasmid . Vector type: Protein expression . Fragment type: . species: . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: Green fluorescence . For Lab research use only

. Alias:L-51543 . Promoter:TetO . Replicator:pUC . Clone strain:Stbl3 . Culture conditions:37centigrade . Host:mammalian cells,Lentivirus . Use:Protein expression . Species:Human . Gene type:ORF . Prokaryotic resistance:Amp . Eukaryotic resistance: . Fluorescent protein:

. G-CaMP3 Search name: G-CaMP3,G-CaMP3 vector,G-CaMP3 plasmid,G-CaMP3 map . G-CaMP3 Information . Bacterial Resistance(s): Kan . Screening: G418 . Growth Strain(s): DH5 alpha . Growth Condition: LB/37 Centigrade

. Promoter: G10 . Replicon: pVS1 . Prokaryotic resistance: Kan . Host: plant . Vector type: Gene editing . Fragment type: CRISPR . species: . Prokaryotic resistance: Kan . Resistance Marker: Hyg . Fluorescent labeling: Green fluorescence . For Lab research use only

. Promoter: . Replicon:pUC . Competent cells:DH5a . Culture temperature:37 degrees . Host：Mammalian cells,Retrovirus . Plasmid use(s):Packaging assistance . Fragment type：ORF . Fragment species：virus . Prokaryotic resistance：Amp . Selectable marker: . Note: Plasmid 14887; . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.

. Promoter: . Replicon:pUC . Competent cells:DH5a . Culture temperature:37 degrees . Host：Mammalian cells . Plasmid use(s):Transcription factor Report . Fragment type：Promoter . Fragment species： . Prokaryotic resistance：Amp . Selectable marker: Hyg . Note: Plasmid 64125; . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.

. Packing 2ug . Function RNA transcription plasmid . Resistance Amp . Screen / . Strain DH5alpha . Culture temperature 37degrees centigrade

. Function ORF expression plasmid . Resistance Amp . Screen / . Strain DH5alpha . Culture temperature 37degrees centigrade . Replicon . Copy . Promoter . Induction . Forward primer . Reverse primer

. Search name: GFP-Rnd1 (Plasmid #23227),Plasmid GFP-Rnd1 (Plasmid #23227),GFP-Rnd1 (Plasmid #23227) vector . Bacterial Resistance:Kanamycin . Growth Strain: . Species human(H. sapiens)

. Search name: GFP-Rnd2 (Plasmid #23228),Plasmid GFP-Rnd2 (Plasmid #23228),GFP-Rnd2 (Plasmid #23228) vector . Bacterial Resistance:Kanamycin . Growth Strain: . Species human(H. sapiens)

. Promoter:CMV . Replicon:pUC . Competent cells:DH5a . Culture temperature:37 degrees . Host：Mammalian cells . Plasmid use(s):Protein expression . Fragment type：ORF . Fragment species：Human . Prokaryotic resistance：Kan . Selectable marker: Neo/G418 . Note: Plasmid 161990; . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.

. Promoter: CMV . Prokaryotic resistance: Amp . Resistance Marker: G418 . Host: - . Vector type: . Fragment type: ORF . species: . Prokaryotic resistance: Amp . Resistance Marker: G418 . Fluorescent labeling: Green fluorescence . For Lab research use only

. GFP-Rab5CA (Q79L) Information . Alternative name: 1-35140 . Promoter: CMV . Replicator: pUC . Clone strain: DH5a . Culture conditions: 37centigrade . GFP-Rab5CA (Q79L) Description . Host: Mammalian cells . Use: Protein expression . Species: Human . Gene type: ORF . Prokaryotic resistance: Kan . Eukaryotic resistance: G418 . Fluorescent protein: . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20ulddH2O in to the tube of plasmid.

. Promoter: CMV . Replicon: pUC . Prokaryotic resistance: Amp . Host: mammalian cells . Vector type: Protein expression . Fragment type: ORF . species: Human . Prokaryotic resistance: Amp . Resistance Marker: Blast . Fluorescent labeling: Green fluorescence . For Lab research use only

. Function ORF expression plasmid . Resistance Amp . Screen Neo/G418 . Strain DH5alpha . Culture temperature 37degrees centigrade . Replicon pUC . Copy Low . Promoter CMV . Induction -- . Forward primer . Reverse primer

. GLP1R-Tango Alternative name: GLP1R-TangoGLP1R-Tango vector, GLP1R-Tango plasmid, GLP1R-Tango map, GLP1R-Tango sequence . GLP1R-Tango Information . Replicator: pUC . Prokaryotic resistance: Amp . Clone strain: JM109 . Culture condition: 37℃ . Plasmid host: mammalian cell . Purpose of plasmid: protein expression . Fragment type: ORF . Fragment species: Human . Prokaryotic resistance: Amp

. Promoter: PbHSP70 . Replicon: pUC . Prokaryotic resistance: Amp . Host: mammalian cells . Vector type: signal report . Fragment type: . species: . Prokaryotic resistance: Amp . Resistance Marker: . Fluorescent labeling: . For Lab research use only

. GPD-roGFP Alternative name: GPD-roGFPGPD-roGFP vector, GPD-roGFP plasmid, GPD-roGFP map, GPD-roGFP sequence, . GPD-roGFP CLONING INFORMATION . Cloning methodRestriction Enzyme . 5′ cloning siteXhoI (not destroyed) . 3′ cloning siteBamHI (not destroyed) . 5′ sequencing primer5'GGCGTGTACGGTGGGAGGTCTATA-3' . 3′ sequencing primer5'-TTAAAAAACCTCCCCACCTCCCCC-3' . GPD-roGFP GROWTH IN BACTERIA . Bacterial Resistance(s) Ampicillin . Growth Temperature 37°C . Growth Strain(s) NEB Stable . Copy number High Copy

. GPR50-Tango PlasmidInformation . Promoter . Prokaryotic resistance Amp . Screening marker G418 . Clone strain DH5a . Culture Conditions LB/37 Celsius degree . Forward primer . Reverse primer . GPR50-Tango Plasmid Description . GPR50-Tango Plasmid is a ORF expression plasmid . NOTE: For research use only!

. Function Mammal Editing plasmids . Resistance / . Screen / . Strain / . Culture temperature . Replicon . Copy . Promoter . Induction . Forward primer . Reverse primer

. Alias:L-41818 . Promoter:U6 . Replicator:pUC . Clone strain:Stbl3 . Culture conditions:37centigrade . Host:mammalian cells . Use:Gene knockout . Species: . Gene type:CRISPR,sgRNA . Prokaryotic resistance:Kan . Eukaryotic resistance: . Fluorescent protein: . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20ul ddH2O in to the tube of plasmid.

. Search name: GSK3B,Plasmid GSK3B,GSK3B vector Bacterial Resistance:Ampicillin . Growth Strain: . Species human(H. sapiens)

. GST-BHMT-I/G Plasmid Alternative Name . GST-BHMT-I/G PlasmidInformation . Promoter CMV . Prokaryotic resistance Amp . Screening marker EGFP . Clone strain DH5a . Culture Conditions LB/37 Celsius degree . Forward primer . Reverse primer . GST-BHMT-I/G Plasmid Description . GST-BHMT-I/G Plasmid is a ORF expression plasmid . NOTE: For research use only!

. Alias:L-91953 . Promoter:CMV . Replicator:pUC . Clone strain:DH5a . Culture conditions:37centigrade . Host:mammalian cells . Use:Protein expression . Species:Empty vector . Gene type:ORF . Prokaryotic resistance:Kan . Eukaryotic resistance:G418 . Fluorescent protein: . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20ul ddH2O in to the tube of plasmid.

. Function Other source plasmids . Promoter: hCMV IE4 promoter . Replicon: pUC ori . Terminator: SV40 poly (A) signal . Plasmid classification: gene library plasmid; other gene plasmids; other source plasmids. . Plasmid size: 7010bp . Prokaryotic resistance: ampicillin Amp (100 g/ml) . Screening marker: neomycin Neo/G418 . Clone: DH5a Escherichia coli . Culture conditions: 37 C, aerobic, LB . Expression host: mammalian cells such as 293T . Culture conditions: 37 C, 5%CO2 . Induction mode: no need to induce . GW1-PercevalHR Description . GW1-PercevalHR drives PercevalHR gene expression through hCMV IE4 promoter.

. Promoter CMV . Prokaryotic resistance Kan . Screening marker GFP . Clone strain DH5a . Culture Conditions LB/37 Celsius degree . Forward primer CMV-F . Reverse primer pFLAG-CMV-R . Gwiz-GFP-bmp2-m Plasmid Description . Gwiz-GFP-bmp2-m Plasmid is a ORF expression plasmid

. Search name: H-FABP ,Plasmid H-FABP ,H-FABP vector . Bacterial Resistance: . Growth Strain: . Species human(H. sapiens)

. Alias:NM_021058.4;H2B/r; H2BFR; H2BJ; HIST1H2BJ；No.11680 . Clone strain:DH5a . Culture conditions:37centigrade . Host：Human . Gene type:ORF . Prokaryotic resistance：Kan . Use：Protein expression . Note: . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20ul ddH2O in to the tube of plasmid.

. H2B-mCherry Plasmid Desciption . Promoter:CMV . Replicon:pUC . Competent cells:DH5a . Culture temperature:37 degrees . Host：Mammalian cells . Plasmid use(s):Protein expression . Fragment type：ORF . Fragment species：Human . Prokaryotic resistance：Amp . Selectable marker: Neo/G418 . Note: Plasmid 20972;NM_021062.3;H2B.1; H2B/f; H2BFF; HIST1H2BB; . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.

. HA Nprl3 pRK5 PlasmidAlias:Plasmid#46330 . Gene length:1710bp . Host: mammalian cells . Use(s): Protein expressionFragment Type: ORF . Fragmented species: Human . Prokaryotic resistance: Amp . Screening Markers: . Promoter: CMV . replicon: pUC . Copy Number: . Competent cells: DH5a . Temperature: 37Degrees . Back Bones: . Forward primer:CMV-F . Reverse primer: . Induction method:

. Function ORF expression plasmid . Resistance Amp . Screen / . Strain Stbl3 . Culture temperature 37degrees centigrade . Replicon . Copy . Promoter . Induction . Forward primer . Reverse primer

. Packing 2ug . Function ORF expression plasmid . Resistance Amp . Screen Zeo . Strain DH5alpha . Culture temperature 37degrees centigrade . Replicon pUC . Copy high . Promoter CMV . Induction -- . Forward primer CMV-F . Reverse primer bGH

. HA-p62(1-385AA) Plasmid Alternative Name: SQSTM1,A170 DMRV FTDALS3 NADGP OSIL PDB3 ZIP3 p60 p62 p62B . HA-p62(1-385AA) PlasmidInformation . Promoter CMV . Prokaryotic resistance Amp . Screening marker Zeo . Clone strain DH5a . Culture Conditions LB/37 Celsius degree . Forward primer . Reverse primer . HA-p62(1-385AA) Plasmid Description . HA-p62(1-385AA) Plasmid is a ORF expression plasmid . NOTE: For research use only!

. HA-p62(124-440AA) Plasmid Alternative Name: SQSTM1,A170 DMRV FTDALS3 NADGP OSIL PDB3 ZIP3 p60 p62 p62B . HA-p62(124-440AA) PlasmidInformation . Promoter CMV . Prokaryotic resistance Amp . Screening marker Zeo . Clone strain DH5a . Culture Conditions LB/37 Celsius degree . Forward primer . Reverse primer . HA-p62(124-440AA) Plasmid Description . HA-p62(124-440AA) Plasmid is a ORF expression plasmid . NOTE: For research use only!

. Alternative Name: HA-P62(230-440aa),HA-P62(230-440aa) vector,HA-P62(230-440aa) plasmid,HA-P62(230-440aa) map,HA-P62(230-440aa) sequence . Plasmid form: Freeze-dried powder . Storage Condition: -20 Centigrade . Bulk order Please contact us: sales@lifescience-market.com . Promoter: CMV . Bacterial Resistance(s): Amp . Screening: Zeo . Growth Strain(s): DH5alpha . Culture Medium: LB . Temperature: 37 Centigrade . Vector Size: . Product is for research use only!

. Promoter: CMV . Replicon: pUC . Growth Strain(s): DH5a . Host: mammalian cells . Vector type: Protein expression . Fragment type: ORF . species: Human . Prokaryotic resistance: Amp . Resistance Marker: G418 . Fluorescent labeling: . For Lab research use only

. Function Other source plasmids . Replicon: ori . Plasmid classification: gene library plasmid; other gene plasmids; other source plasmids. . Plasmid size: 6821bp . Prokaryotic resistance: ampicillin Amp (100 u g/ml) . Cloned strains of Escherichia coli, DH5 A and other Escherichia coli . Culture conditions: 37 centigrade, aerobic, LB . HBV 1.3-mer WT replicon Reference . DDX3 DEAD-Box RNA helicase inhibits hepatitis B virus reverse transcription by incorporation into nucleocapsids.

. HBV 1.3-mer X-null replicon PlasmidAlias: . Gene length: . Host: mammalian cells . Use(s): Protein expressionFragment Type: ORF . Fragmented species: Virus . Prokaryotic resistance: Amp . Screening Markers: . Promoter: . replicon: . Copy Number: . Competent cells: DH5a . Temperature: 37Degrees . Back Bones: . Forward primer: . Reverse primer:

. Function Mammal Editing plasmids . Resistance / . Screen / . Strain / . Culture temperature . Replicon . Copy . Promoter CMV . Induction . Forward primer . Reverse primer

. Search name: hCD40L-T,Plasmid hCD40L-T,hCD40L-T vector . Bacterial Resistance: . Growth Strain: . Species human(H. sapiens)

. Alternative name: 1-13820 . Promoter: CMV . Replicator: pUC . Clone strain: DH5a . Culture conditions: 37centigrade . HDAC1 Flag Description . Host: Mammalian cells . Use: Protein expression . Species: Human . Gene type: ORF . Prokaryotic resistance: Amp . Eukaryotic resistance: G418 . Fluorescent protein: . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20ulddH2O in to the tube of plasmid.

. Function / . Resistance Amp . Screen / . Strain Stbl3 . Culture temperature 37degrees centigrade . Replicon . Copy . Promoter . Induction . Forward primer . Reverse primer

. Function / . Resistance Amp . Screen / . Strain Stbl3 . Culture temperature 37degrees centigrade . Replicon . Copy . Promoter . Induction . Forward primer . Reverse primer

. Function / . Resistance Amp . Screen / . Strain Stbl3 . Culture temperature 37degrees centigrade . Replicon . Copy . Promoter . Induction . Forward primer . Reverse primer

. Function / . Resistance Amp . Screen / . Strain Stbl3 . Culture temperature 37degrees centigrade . Replicon . Copy . Promoter . Induction . Forward primer . Reverse primer

. HIP-flash Description . Alias:1LSM-83466 . Replicator:pUC . Clone strain:DH5a . Culture conditions:37centigrade . Host:mammalian cells . Use:Signal report . Species: . Gene type:Promoter . Prokaryotic resistance:Amp . Eukaryotic resistance: . Fluorescent protein:fLuc . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20ul ddH2O in to the tube of plasmid.

. His-LacZ Alternative name: His-LacZHis-LacZ vector, His-LacZ plasmid, His-LacZ map, His-LacZ sequence, . Promoter - . Replicon - . Terminator - . Resistance - . Strain - . Culture conditions - . Forward primer - . Reverse primer -

. Search name: HLA-B-spe,Plasmid HLA-B-spe,HLA-B-spe vector . Bacterial Resistance: . Growth Strain: . Species human(H. sapiens)

. Search name: HMGB1,Plasmid HMGB1,HMGB1 vector . Bacterial Resistance:Kanamycin . Growth Strain: . Species human(H. sapiens)

. Product Name:hOC-GFPtpz . Promoter: BGLAP . Replicon: pUC . Prokaryotic resistance: Amp . Host: mammalian cells . Vector type: signal report . Fragment type: Promoter . species: Human . Prokaryotic resistance: Amp . Resistance Marker: . Fluorescent labeling: Green fluorescence . For Lab research use only

. Alias:1LSM-83467 . Replicator:pUC . Clone strain:DH5a . Culture conditions:37centigrade . Host:mammalian cells . Use:Signal report . Species: . Gene type:Promoter . Prokaryotic resistance:Amp . Eukaryotic resistance: . Fluorescent protein:fLuc

. Promoter: HRE . Replicon: pUC . Prokaryotic resistance: Amp . Host: mammalian cells . Vector type: signal report . Fragment type: Promoter . species: . Prokaryotic resistance: Amp . Resistance Marker: . Fluorescent labeling: . For Lab research use only

. Hs.KRAS4b G12D PlasmidInformation . Promoter . Prokaryotic resistance Str . Screening marker . Clone strain DH5a . Culture Conditions LB/37 Celsius degree . Forward primer . Reverse primer . Hs.KRAS4b G12D Plasmid Description . Hs.KRAS4b G12D Plasmid is a DNA cloning plasmid . NOTE: For research use only!

. Packing 2ug . Function ORF expression plasmid . Resistance / . Screen / . Strain / . Culture temperature . Replicon . Copy . Promoter . Induction . Forward primer . Reverse primer

. Human brain cDNA Clone Libraries Information . Note: Human brain tissue; pAP3neo backbones . Promoter:- . Replicator: pUC . Competent cells: DH5a . Culture temperature: 37 degrees . Host: Escherichia coli . Uses: Gene template . egment type: cDNA . ragment species: Human . Prokaryotic resistance: Amp . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.

. Promoter:U6 . Replicon:pUC . Competent cells:Stbl3 . Culture temperature:37 degrees . Host：Mammalian cells,Lentivirus . Plasmid use(s):Gene knockout . Fragment type：CRISPR . Fragment species：Human . Prokaryotic resistance：Amp . Selectable marker: Puro . Note: Pooled Library#1000000048;(Please inquiry us before place an order); . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.

. Promoter:U6 . Replicon:pUC . Competent cells:Stbl3 . Culture temperature:37 degrees . Host：Mammalian cells,Lentivirus . Plasmid use(s):Gene knockout . Fragment type：CRISPR . ragment species：Human . Prokaryotic resistance：Amp . Selectable marker: Puro . Note: Pooled Library#1000000048;(Please inquiry us before place an order); . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.

. Promoter:CMV . Replicon:pUC . Competent cells:DH5a . Culture temperature:37 degrees . Host：Mammalian cells . Plasmid use(s):Protein expression . Fragment type：ORF . Fragment species：Human . Prokaryotic resistance：Amp . Selectable marker: Neo/G418 . Note: Plasmid 16828; . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.

. Alias:L-87021 . Replicator:pUC . Clone strain:DH5a . Culture conditions:37centigrade . Host:mammalian cells . Use:Protein expression . Species:Mouse . Gene type:ORF . Prokaryotic resistance:Amp . Eukaryotic resistance: . Fluorescent protein:Red . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20ul ddH2O in to the tube of plasmid.

. Search name: IFITM3,Plasmid IFITM3,IFITM3 vector . Bacterial Resistance: . Growth Strain: . Species human(H. sapiens)

. IFN-Beta_pGL3 Search name: IFN-Beta_pGL3,IFN-Beta_pGL3 vector,IFN-Beta_pGL3 plasmid,IFN-Beta_pGL3 map . IFN-Beta_pGL3 Information . Bacterial Resistance(s): Amp . Screening: Luc . Growth Strain(s): Stbl3 . Growth Condition: LB/30 Centigrade

. Backbone vector: IFP2.0-N1 . Vector type: Mammalian Expression . Bacterial Resistance: Kan . Growth Temperature: 37°C . Growth Strain:DH5alpha . Copy number: High . Gene Insert name: miRFP670nano . Tags: Neomycin (select with G418) . Note: Near infrared fluorescent protein plasmid . Caution: 1. This product is FOR RESEARCH USE ONLY!

. Search name: IGF-1,Plasmid IGF-1,IGF-1 vector . Bacterial Resistance:Ampicillin . Growth Strain: . Species human(H. sapiens)

. Packing 2ug . Function Promoter plasmid . Resistance Amp . Screen Luc . Strain DH5alpha . Culture temperature 37degrees centigrade . Replicon pUC . Copy high . Promoter . Induction . Forward primer . Reverse primer

IKKalpha (S176ES180E)-pcw107-V5 Search name: IKKalpha (S176ES180E)-pcw107-V5,IKKalpha (S176ES180E)-pcw107-V5 vector,IKKalpha (S176ES180E)-pcw107-V5 plasmid,IKKalpha (S176ES180E)-pcw107-V5 map . IKKalpha (S176ES180E)-pcw107-V5 Information . Bacterial Resistance(s): Amp . Screening: Puro . Growth Strain(s): Stbl3 . Growth Condition: LB/37 Centigrade

. Search name: IL6,Plasmid IL6,IL6 vector . Bacterial Resistance:Kanamycin . Growth Strain: . Species human(H. sapiens)

. Search name INSL3,Plasmid INSL3,INSL3 vector . Bacterial Resistance:Spe . Growth Strain: . Species human(H. sapiens)

. Replicon:pVS1 . Competent cells:DH5a . Culture temperature:37 degrees . Host：Plant . Plasmid use(s):Gene knockout . Fragment type：CRISPR . Fragment species： . Prokaryotic resistance：Kan . Selectable marker: Hyg . Note: Plasmid 160393; . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.

. Alternative Name: jk100 pSinEGdsp,jk100 pSinEGdsp vector,jk100 pSinEGdsp plasmid,jk100 pSinEGdsp map,jk100 pSinEGdsp sequence . Plasmid form: Freeze-dried powder . Storage Condition: -20 Centigrade . Bulk order Please contact us: sales@lifescience-market.com . Promoter: inquiry . Bacterial Resistance(s): Amp . Screening: EGFP . Growth Strain(s): Stbl3 . Culture Medium: LB . Temperature: 37 Centigrade . Vector Size: . Product is for research use only!

. Alias:No.129656 . Clone strain:DH5a . Culture conditions:37centigrade . Host： . Gene type:CRISPR,Cas9 . Prokaryotic resistance：Amp . Use：Gene knockout . Note: . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20ul ddH2O in to the tube of plasmid.

. Alias:No.129660 . Clone strain:DH5a . Culture conditions:37centigrade . Host： . Gene type:CRISPR,Cas9 . Prokaryotic resistance：Amp . Use：Gene knockout . Note: . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20ul ddH2O in to the tube of plasmid.

. Kif1bβ-pcDNA3 PlasmidAlias: . Gene length:5313bp . Host: mammalian cells . Use(s): Protein expressionFragment Type: ORF . Fragmented species: . Prokaryotic resistance: Amp . Screening Markers: Neo/G418 . Promoter: CMV . replicon: pUC . Copy Number: . Competent cells: DH5a . Temperature: 37Degrees . Back Bones: . Forward primer: . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.Take 2ul plasmid into 100 μ L corresponding competent cell, centrifugal then full coating on plate. 3. Shipping temperature is 2-8 degrees centigrade.

. Alias:No.102252 . Clone strain:DH5a . Culture conditions:37centigrade . Host：Rat,Arabidopsis thaliana . Gene type:ORF . Prokaryotic resistance：Kan . Use：Protein expression . Note: . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20ul ddH2O in to the tube of plasmid.

. Promoter:CMV . Replicon:pUC . Competent cells:DH5a . Culture temperature:37 degrees . Host：Mammalian cells . Plasmid use(s):Protein expression . Fragment type：ORF . Fragment species：virus . Prokaryotic resistance：Amp . Selectable marker: Neo/G418 . Note: Plasmid 103011; . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.

. Function / . Resistance Amp . Screen / . Strain Stbl3 . Culture temperature 37degrees centigrade . Replicon . Copy . Promoter . Induction . Forward primer . Reverse primer

. Function / . Resistance Amp . Screen / . Strain Stbl3 . Culture temperature 37degrees centigrade . Replicon . Copy . Promoter . Induction . Forward primer . Reverse primer

. Promoter: T7 . Replicator: pUC ori, F1 ori . Plasmid classification: nematode RNAI interference vector; Worm Expression RNAi . Plasmid size: 2790bp . Plasmid label: lacZN, OriF1 . Prokaryotic resistance: ampicillin Ampicillin . Cloned strain: DH5 alpha . Culture conditions: 37 centigrade, aerobic, LB . Expression host: nematode, worm . Induction mode: IPTG . 5'sequencing primers: Based on full sequence design

. Packing 2ug . Function Bovine source gene yeast expression plasmid . Resistance Amp . Screen URA3 . Strain DH5alpha . Culture temperature 37degrees centigrade . Replicon pUC . Copy . Promoter . Induction . Forward primer T7 . Reverse primer

. Promoter: CMV . Replicon: pUC . Prokaryotic resistance: Kan . Host: mammalian cells . Vector type: Protein expression . Fragment type: ORF . species: Rat . Prokaryotic resistance: Kan . Resistance Marker: G418 . Fluorescent labeling: Red fluorescence . For Lab research use only

. Function Promoter plasmid . Resistance Amp . Screen Hyg . Strain DH5alpha . Culture temperature 37degrees centigrade . Replicon . Copy . Promoter . Induction . Forward primer . Reverse primer

. Function Promoter plasmid . Resistance Amp . Screen Hyg . Strain DH5alpha . Culture temperature 37degrees centigrade . Replicon . Copy . Promoter . Induction . Forward primer . Reverse primer

. Function Promoter plasmid . Resistance Amp . Screen Hyg . Strain DH5alpha . Culture temperature 37degrees centigrade . Replicon . Copy . Promoter . Induction . Forward primer . Reverse primer

. lias:No.102566 . Clone strain:Stbl3 . Culture conditions:37centigrade . Host： . Gene type:CRISPR . Prokaryotic resistance：Amp . Use：Gene knockout . Note: . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20ul ddH2O in to the tube of plasmid.

. Alias:No.155099 . Clone strain:Stbl3 . Culture conditions:37centigrade . Host：empty vector . Gene type:CRISPR,sgRNA . Prokaryotic resistance：Amp . Use：Gene knockout . Note: . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20ul ddH2O in to the tube of plasmid.

. Alias:No.85213 . Clone strain:Stbl3 . Culture conditions:37centigrade . Host：ORF . Gene type:Cre/Loxp . Prokaryotic resistance：Amp . Use：Gene knockout . Note: . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20ul ddH2O in to the tube of plasmid.

. Search name: Lenti dcas VP64-Blast,Plasmid Lenti dcas VP64-Blast,Lenti dcas VP64-Blast vector . Lenti dcas VP64-Blast Information . Plasmid type: CRISPR/Cas9 vector; gene knockout vector; mammalian vector . High copy / low copy: high copy . Cloning method: BsiWI, EcoRI . Promoter: EF1 . Carrier size: 14085 BP . 5'sequencing primers and sequences: GTTTGGATCTTGGTTCATTCTCAAGCCTCAG . 3'sequencing primers and sequences: cacatagcgtaaaaggagcaacatag . Carrier label: - . Vector resistance: ampicillin (Ampicilin) . Screening markers: Blasticidin . Cloned strain: Stbl3 . Host cells (lines): mammalian cells . Note: Mutation D10A and N863A in Cas9 . Stability: stable expression . Composition / inducible type: composition . Virus / non virus: slow disease . Use:CRISPR-CAS27-sgRNA plasmid

. lenti dCAS-VP64_Blast vector Information: . Product Name: lenti dCAS-VP64_Blast vector . Bacterial Resistance: Amp . Selectable markers: Blast . Growth Strain: Stbl3 . Growth Temperature: LB/37Centigrade degree

. lenti MS2-P65-HSF1_Hygro Information . Promoter: - . Replicator: pUC . Competent cells: Stbl3 . Culture temperature: 37 degrees . Plasmid host: Mammalian cells, lentivirus . Plasmid uses: Gene knockout, Mammal Editing plasmids . Prokaryotic resistance: Amp . Filter Tags: Hyg

. Lenti MS2-P65-HSF1_Neo PlasmidAlias: . Gene length: . Host: mammalian cells,Lentivirus . Use(s): gene editingFragment Type: CRISPR . Fragmented species: . Prokaryotic resistance: Amp . Screening Markers: Neo/G418 . Promoter: EF1a . replicon: pUC . Copy Number: . Competent cells: DH5a . Temperature: 37Degrees . Back Bones: . Forward primer: . Reverse primer:

. Function / . Resistance / . Screen / . Strain / . Culture temperature . Replicon . Copy . Promoter . Induction . Forward primer . Reverse primer

. Packing 2ug . Function / . Resistance Amp . Screen Zeo . Strain Stbl3 . Culture temperature LB/37

. Lenti-Cas9-Puro Information: . Use(s): Gene Editing . Prokaryotic resistance: Amp . Screening maker : Puro, Zero . Replicon: pUC . Competent cells : Stbl3 . Temperature: 37 degrees . Lenti-Cas9-Puro Description . Function Mammal Editing plasmids

. Search name: lenti-sgRNA-TagRFP-uspzz-1,Plasmid lenti-sgRNA-TagRFP-uspzz-1,lenti-sgRNA-TagRFP-uspzz-1 vector . Bacterial Resistance:Ampicillin . Growth Strain: . Species human(H. sapiens)

. Search name: lenti-sgRNA-TagRFP-uspzz-2,Plasmid lenti-sgRNA-TagRFP-uspzz-2,lenti-sgRNA-TagRFP-uspzz-2 vector . Bacterial Resistance:Ampicillin . Growth Strain: . Species human(H. sapiens)

. Search name: lenti-sgRNA-TagRFP-uspzz-3,Plasmid lenti-sgRNA-TagRFP-uspzz-3,lenti-sgRNA-TagRFP-uspzz-3 vector . Bacterial Resistance:Ampicillin . Growth Strain: . Species human(H. sapiens)

. Product Name:Lenti-(BB)-EF1a-KRAB-dCas9-P2A-EGFP . Promoter: EF1a,U6 . Prokaryotic resistance: Amp . Resistance Marker: EGFP . Host: mammalian cells . Vector type: Gene editing . Fragment type: . species: . Prokaryotic resistance: Amp . Resistance Marker: . Fluorescent labeling: Green fluorescence . For Lab research use only

. Alias:No.84750 . Clone strain:Stbl3 . Culture conditions:37centigrade . Host： . Gene type:CRISPR . Prokaryotic resistance：Amp . Use：Gene knockout . Note: . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20ul ddH2O in to the tube of plasmid.

. Lenti-dCas9-KRAB-blast Informaiton . Function Mammal Editing plasmids . Promoter: EF-1 alpha promoter . Terminator: WPRE . Plasmid size: 14229bp . Prokaryotic resistance: N-nucleoplasmin NLS, C-SV40 NLS . Screening marker: bleomycin Zeo, magnaporin Blast . Cloned strain: Escherichia coli Stbl3 . Culture conditions: 37℃, aerobic, LB . Lenti-dCas9-KRAB-blast Description Lenti-dCas9-KRAB-blast is a lentivirus overexpression plasmid, and the EF-1 alpha promoter drives the expression of the dCas9-KRAB protein fragment. It can be used in the gene editing experiment of mammalian cells. References to essential granules are: Multiplexed Engineering and Analysis of Combinatorial Enhancer Activity in Single Cells.

. lenti-EF1a-dCas9-KRAB-Puro vector Information: . Product Name: lenti-EF1a-dCas9-KRAB-Puro vector . Bacterial Resistance: Amp . Selectable markers: Puro . Growth Strain: Stbl3 . Growth Temperature: LB/37Centigrade degree . Copy number: High Copy . 5′ sequencing primer: GTTTGGATCTTGGTTCATTCTCAAGCCTCAG . 3′ sequencing primer: cacatagcgtaaaaggagcaacatag . Caution: Product is for research use only!

. Promoter: EF1a . Replicon: pUC . Prokaryotic resistance: Amp . Host: mammalian cells . Vector type: Gene editing . Fragment type: CRISPR . species: . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Promoter: EF1a . Replicon: pUC . Prokaryotic resistance: Amp . Host: lentiviral plasmid . Vector type: Transcriptional regulation . Fragment type: ncRNA . species: Human . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Promoter: EF1a . Replicon: pUC . Prokaryotic resistance: Amp . Host: lentiviral plasmid . Vector type: Transcriptional regulation . Fragment type: ncRNA . species: Human . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Lenti-EF1a-SLC5A5-FLAG-T2A-EGFP-PGK-Puro Information . Alternative name: NM_000453.3;NIS; TDH1 . Promoter: EF1a . Replicator: pUC . Clone strain: Stbl3 . Culture conditions: 37centigrade . Note: 1929bp . Lenti-EF1a-SLC5A5-FLAG-T2A-EGFP-PGK-Puro Description . Host: Mammalian cells,Lentivirus . Use: Protein expression . Species: . Gene type: ORF . Prokaryotic resistance: Amp . Eukaryotic resistance: Puro . Fluorescent protein: Green . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20ulddH2O in to the tube of plasmid. 3. (human);

. Promoter:Tet . Replicon:pUC . Competent cells:Stbl3 . Culture temperature:37 degrees . Host：Mammalian cells,Lentivirus . Plasmid use(s):Gene knockout . Fragment type：CRISPR . Fragment species： . Prokaryotic resistance：Amp . Selectable marker: Neo/G418 . Note: Plasmid 85400; . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.

. Alias:L-105621 . Promoter:EFS . Replicator:pUC . Clone strain:Stbl3 . Culture conditions:37centigrade . Host:mammalian cells,Lentivirus . Use:Protein expression . Species: . Gene type:ORF . Prokaryotic resistance:Amp . Eukaryotic resistance:G418 . Fluorescent protein:fLuc

. Lenti-SFFV-PPP2R2B-P2A-Puro PlasmidAlias:NM_181674.3;B55BETA; PP2AB55BETA; PP2ABBETA; PP2APR55B;PP2APR55BETA; PR2AB55BETA; PR2ABBETA; PR2APR55BETA; PR52B;PR55-BETA; PR55BETA; SCA12 . Gene length:1527bp . Host: mammalian cells,Lentivirus . Use(s): Protein expressionFragment Type: ORF . Fragmented species: Human . Prokaryotic resistance: Amp . Screening Markers: Puro . Green . Promoter: SFFV . replicon: pUC . Copy Number: . Competent cells: Stbl3 . Temperature: 37Degrees . Back Bones: . Forward primer: . Reverse primer:

. LentiCas9-EGFP Information: . Function Mammal Editing plasmids . Resistance Amp . Screen Zeo . Strain Stbl3 . Culture temperature 37degrees centigrade . Promoter: EF-1 alpha core promoter . Copier: Ori, F1 ori, SV40 ori . Terminator: WPRE . Plasmid classification: mammalian cell plasmid; mammalian editing plasmid; mammalian Cas9 plasmid . Plasmid size: 13177 BP . Plasmid tags: C-nucleoplasmin NLS, C-FLAG, C-EGFP . Prokaryotic resistance: ampicillin Amp . Screening Marker: Bleomycin Zeo . Cloning strain: Escherichia coli Stbl3 . Culture conditions: 37 C, aerobic, LB . Expressing host: mammalian cells such as 293T . LentiCas9-EGFP Description . Expresses human codon-optimized S. pyogenes Cas9 protein and EGFP from EFS promoter. 3rd generation lentiviral backbone. . LentiCas9-EGFP Reference . Genome-wide CRISPR screen in a mouse model of tumor growth and metastasis.

. Alternative Name: lentiCRISPR; lentiCRISPR V1 . Promoter: U6 . Replicator: pUC . Prokaryotic resistance: Amp . Filter marker: Puro . Clone strain: stbl3 . Culture condition: 37 ℃ . Vector host: mammalian cells, lentivirus . Application of vector: gene editing . Gene species: empty body . Gene type: CRISPR . Prokaryotic resistance: Amp . Eukaryotic resistance: Puro . Use:CRISPR-CAS23-sgRNA plasmid

. Promoter:U6 . Replicon:pUC . Competent cells:Stbl3 . Culture temperature:37 degrees . Host：Mammalian cells,Lentivirus . Plasmid use(s):Gene knockout . Fragment type：CRISPR,Cas9,sgRNA . Fragment species：empty vector . Prokaryotic resistance：Amp . Selectable marker: Blast . Note: Plasmid 83480; . Caution: 1. This product is FOR RESEARCH USE ONLY! 2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.

. Product Name:LentiCRISPR V2-control-sgRNA . Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Product Name:LentiCRISPR V2-CRACD-sgRNA1 . Replicon: pUC . Prokaryotic resistance: Amp . Resistance Marker: Puro . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Human . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Product Name:LentiCRISPR V2-CRACD-sgRNA3 . Replicon: pUC . Prokaryotic resistance: Amp . Resistance Marker: Puro . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Human . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Product Name:LentiCRISPR V2-DHODH-sgRNA2 . Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Human . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Product Name:LentiCRISPR V2-TRPC5-sgRNA2 . Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Mouse . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Product Name:LentiCRISPR V2-Trpv2-sgRNA1 . Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Mouse . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Product Name:LentiCRISPR V2-Trpv2-sgRNA2 . Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Mouse . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Plasmid type: Cas9 editing plasmids of mammalian cells . Cloned strain: Escherichia coli Stbl3 . Prokaryotic resistance: ampicillin Amp (100 u g/ml) . Screening markers: purinomycin Puro . Use:CRISPR-CAS24-sgRNA plasmid

. Product Name:LentiCRISPRv2 hygro . Promoter: U6 . Replicon: pUC . Prokaryotic resistance: Amp . Host: lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR . species: empty vector . Prokaryotic resistance: Amp . Resistance Marker: Hyg . Fluorescent labeling: . For Lab research use only

. Promoter U6 . Prokaryotic resistance Amp . Screening marker G418 . Clone strain Stbl3 . Culture Conditions LB/37 Celsius degree . Forward primer U6 . Reverse primer . lentiCRISPRv2 neo Plasmid Description . lentiCRISPRv2 neo Plasmid is a Lactation editing plasmid . NOTE: For research use only!

. Product Name:LentiCRISPRV2- Ano6-sgRNA1 . Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Mouse . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Mouse . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Mouse . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Product Name:LentiCRISPRV2-Ano1-sgRNA2 . Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Mouse . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Product Name:LentiCRISPRV2-Ano10-sgRNA1 . Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Mouse . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Mouse . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Human . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Human . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Mouse . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Mouse . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. LentiCRISPRV2-SQSTM1sgRNA1 PlasmidInformation . Promoter . Prokaryotic resistance Amp . Screening marker Puro . Clone strain DH5a . Culture Conditions LB/37 Celsius degree . Forward primer . Reverse primer . LentiCRISPRV2-SQSTM1sgRNA1 Plasmid Description . LentiCRISPRV2-SQSTM1sgRNA1 Plasmid is a RNA transcription plasmid . NOTE: For research use only!

. Promoter . Prokaryotic resistance Amp . Screening marker Puro . Clone strain DH5a . Culture Conditions LB/37 Celsius degree . Forward primer . Reverse primer . LentiCRISPRV2-SQSTM1sgRNA2 Plasmid Description . LentiCRISPRV2-SQSTM1sgRNA2 Plasmid is a RNA transcription plasmid . NOTE: For research use only!

. Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Mouse . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Mouse . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Mouse . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Mouse . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Mouse . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Mouse . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only

. Replicon: pUC . Growth Strain(s): Stbl3 . Culture conditions: 37Centigrade . Host: mammalian cells,lentiviral plasmid . Vector type: Gene editing . Fragment type: CRISPR,Cas9,sgRNA . species: Mouse . Prokaryotic resistance: Amp . Resistance Marker: Puro . Fluorescent labeling: . For Lab research use only