Your go-to online shop for laboratory and test products. Our website offers you the convenience of accessing our complete product range in one place. With just a click, you can explore a diverse selection of high-quality laboratory equipment, reagents, consumables, and diagnostic kits. We have carefully curated our inventory to cater to various scientific disciplines, ensuring that you find everything you need for your research, diagnostics, or quality control endeavors. Experience the ease of browsing and finding the right products for your laboratory needs on our user-friendly website.
Order-No. | Product name | Tests/Size | Intended use | Quote Request |
---|---|---|---|---|
PVT5401 | L4440 | Packing 2ug | . Promoter: T7
. Replicator: pUC ori, F1 ori
. Plasmid classification: nematode RNAI interference vector; Worm Expression RNAi
. Plasmid size: 2790bp
. Plasmid label: lacZN, OriF1
. Prokaryotic resistance: ampicillin Ampicillin
. Cloned strain: DH5 alpha
. Culture conditions: 37 centigrade, aerobic, LB
. Expression host: nematode, worm
. Induction mode: IPTG
. 5'sequencing primers: Based on full sequence design | |
PVT10544 | LACT- C2- GFP- P416 | Packing 2ug | . Packing 2ug
. Function Bovine source gene yeast expression plasmid
. Resistance Amp
. Screen URA3
. Strain DH5alpha
. Culture temperature 37degrees centigrade
. Replicon pUC
. Copy
. Promoter
. Induction
. Forward primer T7
. Reverse primer | |
PVT20759 | LAMP1-RFP | Packing 2ug | . Promoter: CMV
. Replicon: pUC
. Prokaryotic resistance: Kan
. Host: mammalian cells
. Vector type: Protein expression
. Fragment type: ORF
. species: Rat
. Prokaryotic resistance: Kan
. Resistance Marker: G418
. Fluorescent labeling: Red fluorescence
. For Lab research use only | |
PVT10424 | LB1366 (BCL- 2 PROMOTER WITH MHS1234) | Packing 2ug | . Function Promoter plasmid
. Resistance Amp
. Screen Hyg
. Strain DH5alpha
. Culture temperature 37degrees centigrade
. Replicon
. Copy
. Promoter
. Induction
. Forward primer
. Reverse primer | |
PVT10423 | LB1376 (BCL- 2 P1 PROMOTER WITH MHS1234) | Packing 2ug | . Function Promoter plasmid
. Resistance Amp
. Screen Hyg
. Strain DH5alpha
. Culture temperature 37degrees centigrade
. Replicon
. Copy
. Promoter
. Induction
. Forward primer
. Reverse primer | |
PVT10422 | LB1377 (BCL- 2 P2 PROMOTER WITH MHS1234) | Packing 2ug | . Function Promoter plasmid
. Resistance Amp
. Screen Hyg
. Strain DH5alpha
. Culture temperature 37degrees centigrade
. Replicon
. Copy
. Promoter
. Induction
. Forward primer
. Reverse primer | |
PVT36065 | LBCPF1-2NLS | Packing 2ug | . lias:No.102566
. Clone strain:Stbl3
. Culture conditions:37centigrade
. Host:
. Gene type:CRISPR
. Prokaryotic resistance:Amp
. Use:Gene knockout
. Note:
. Caution:
1. This product is FOR RESEARCH USE ONLY!
2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20ul ddH2O in to the tube of plasmid. | |
PVT39759 | LCV2_MCLOVER3_AAVS1_SGRNA_2 | Packing 2ug | . Alias:No.155099
. Clone strain:Stbl3
. Culture conditions:37centigrade
. Host:empty vector
. Gene type:CRISPR,sgRNA
. Prokaryotic resistance:Amp
. Use:Gene knockout
. Note:
. Caution:
1. This product is FOR RESEARCH USE ONLY!
2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20ul ddH2O in to the tube of plasmid. | |
PVT36725 | LEGO-EBFP2 | Packing 2ug | . Alias:No.85213
. Clone strain:Stbl3
. Culture conditions:37centigrade
. Host:ORF
. Gene type:Cre/Loxp
. Prokaryotic resistance:Amp
. Use:Gene knockout
. Note:
. Caution:
1. This product is FOR RESEARCH USE ONLY!
2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20ul ddH2O in to the tube of plasmid. | |
PVTY00599 | LEGO-IC2 | Packing 2ug | . LeGO-iC2 Description:
Plasmid type:Lentiviral vectorCopy Number:High copyCloning Method:Multiple cloning sites,restriction endonucleaseSize:7820 bp 5' Sequencing primers and sequences:GAGCTCACAACCCCTCACTCResistance(s):Ampicillin (Amp)Note:cloning strain is Stbl3 or TOP10
. Caution:
1. This product is FOR RESEARCH USE ONLY! | |
PVTY00200 | LEGO-IG | Packing 2ug | . LeGO-iG Description:
Plasmid type:Lentivirus expression Plasmid, RNAi vectorPromoter:SFFV, U6Size:8159 bp Resistance(s):AmpicillinReporter gene:EGFP
. Caution:
1. This product is FOR RESEARCH USE ONLY! | |
PVTY00199 | LEGO-Y | Packing 2ug | . LeGO-Y Description
. Plasmid type:RNAi
. vectorPromoter:SFFV,
. U6Size:7467 bp
. Resistance(s):AmpicillinReporter
. gene:EYFP
. Caution:
1. This product is FOR RESEARCH USE ONLY! | |
PVT6318 | LENTI DCAS VP64- BLAST PLASMID | Packing 2ug | . Search name: Lenti dcas VP64-Blast,Plasmid Lenti dcas VP64-Blast,Lenti dcas VP64-Blast vector
. Lenti dcas VP64-Blast Information
. Plasmid type: CRISPR/Cas9 vector; gene knockout vector; mammalian vector
. High copy / low copy: high copy
. Cloning method: BsiWI, EcoRI
. Promoter: EF1
. Carrier size: 14085 BP
. 5'sequencing primers and sequences: GTTTGGATCTTGGTTCATTCTCAAGCCTCAG
. 3'sequencing primers and sequences: cacatagcgtaaaaggagcaacatag
. Carrier label: -
. Vector resistance: ampicillin (Ampicilin)
. Screening markers: Blasticidin
. Cloned strain: Stbl3
. Host cells (lines): mammalian cells
. Note: Mutation D10A and N863A in Cas9
. Stability: stable expression
. Composition / inducible type: composition
. Virus / non virus: slow disease
. Use:CRISPR-CAS27-sgRNA plasmid | |
PVTY00188 | LENTI DCAS-VP64_BLAST | Packing 2ug | . lenti dCAS-VP64_Blast Description
. Plasmid type: Lentiviral expression vector,CRISPR-Cas9 system
. Promoter: EF1a
. Size: 14085 bp
. Resistance(s): Ampicillin
. Selectable markers: Blasticidin
. Note: 3rd generation lenti vector encoding dCAS9-VP64 with 2A Blast resistance marker (EF1a-NLS-dCas9(N863)-VP64-2A-Blast-WPRE) | |
PVT12113 | LENTI DCAS-VP64_BLAST VECTOR | Packing 2ug | . lenti dCAS-VP64_Blast vector Information:
. Product Name: lenti dCAS-VP64_Blast vector
. Bacterial Resistance: Amp
. Selectable markers: Blast
. Growth Strain: Stbl3
. Growth Temperature: LB/37Centigrade degree | |
PVT10995 | LENTI MS2- P65- HSF1_HYGRO | Packing 2ug | . lenti MS2-P65-HSF1_Hygro Information
. Promoter: -
. Replicator: pUC
. Competent cells: Stbl3
. Culture temperature: 37 degrees
. Plasmid host: Mammalian cells, lentivirus
. Plasmid uses: Gene knockout, Mammal Editing plasmids
. Prokaryotic resistance: Amp
. Filter Tags: Hyg | |
PVT49504 | LENTI MS2-P65-HSF1_NEO PLASMID | Packing 2ug | . Lenti MS2-P65-HSF1_Neo PlasmidAlias:
. Gene length:
. Host: mammalian cells,Lentivirus
. Use(s): gene editingFragment Type: CRISPR
. Fragmented species:
. Prokaryotic resistance: Amp
. Screening Markers: Neo/G418
. Promoter: EF1a
. replicon: pUC
. Copy Number:
. Competent cells: DH5a
. Temperature: 37Degrees
. Back Bones:
. Forward primer:
. Reverse primer: | |
PVT11345 | LENTI SGRNA (MS2)_PURO BACKBONE | Packing 2ug | . Function /
. Resistance /
. Screen /
. Strain /
. Culture temperature
. Replicon
. Copy
. Promoter
. Induction
. Forward primer
. Reverse primer | |
PVT11344 | LENTI SGRNA (MS2)_ZEO BACKBONE | Packing 2ug | . Packing 2ug
. Function /
. Resistance Amp
. Screen Zeo
. Strain Stbl3
. Culture temperature LB/37 | |
PVT10981 | LENTI- CAS9- PURO | Packing 2ug | . Lenti-Cas9-Puro Information:
. Use(s): Gene Editing
. Prokaryotic resistance: Amp
. Screening maker : Puro, Zero
. Replicon: pUC
. Competent cells : Stbl3
. Temperature: 37 degrees
. Lenti-Cas9-Puro Description
. Function Mammal Editing plasmids | |
PVT7230 | LENTI- SGRNA- TAGRFP- USPZZ- 1 PLASMID | Packing 2ug | . Search name: lenti-sgRNA-TagRFP-uspzz-1,Plasmid lenti-sgRNA-TagRFP-uspzz-1,lenti-sgRNA-TagRFP-uspzz-1 vector
. Bacterial Resistance:Ampicillin
. Growth Strain:
. Species human(H. sapiens) | |
PVT7231 | LENTI- SGRNA- TAGRFP- USPZZ- 2 PLASMID | Packing 2ug | . Search name: lenti-sgRNA-TagRFP-uspzz-2,Plasmid lenti-sgRNA-TagRFP-uspzz-2,lenti-sgRNA-TagRFP-uspzz-2 vector
. Bacterial Resistance:Ampicillin
. Growth Strain:
. Species human(H. sapiens) | |
PVT7232 | LENTI- SGRNA- TAGRFP- USPZZ- 3 PLASMID | Packing 2ug | . Search name: lenti-sgRNA-TagRFP-uspzz-3,Plasmid lenti-sgRNA-TagRFP-uspzz-3,lenti-sgRNA-TagRFP-uspzz-3 vector
. Bacterial Resistance:Ampicillin
. Growth Strain:
. Species human(H. sapiens) | |
PVT19836 | LENTI-(BB)-EF1A-KRAB-DCAS9-P2A-EGFP | Packing 2ug | . Product Name:Lenti-(BB)-EF1a-KRAB-dCas9-P2A-EGFP
. Promoter: EF1a,U6
. Prokaryotic resistance: Amp
. Resistance Marker: EGFP
. Host: mammalian cells
. Vector type: Gene editing
. Fragment type:
. species:
. Prokaryotic resistance: Amp
. Resistance Marker:
. Fluorescent labeling: Green fluorescence
. For Lab research use only | |
PVT36500 | LENTI-ASCPF1-BLAST | Packing 2ug | . Alias:No.84750
. Clone strain:Stbl3
. Culture conditions:37centigrade
. Host:
. Gene type:CRISPR
. Prokaryotic resistance:Amp
. Use:Gene knockout
. Note:
. Caution:
1. This product is FOR RESEARCH USE ONLY!
2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20ul ddH2O in to the tube of plasmid. | |
PVT10919 | LENTI-DCAS9-KRAB-BLAST | Packing 2ug | . Lenti-dCas9-KRAB-blast Informaiton
. Function Mammal Editing plasmids
. Promoter: EF-1 alpha promoter
. Terminator: WPRE
. Plasmid size: 14229bp
. Prokaryotic resistance: N-nucleoplasmin NLS, C-SV40 NLS
. Screening marker: bleomycin Zeo, magnaporin Blast
. Cloned strain: Escherichia coli Stbl3
. Culture conditions: 37℃, aerobic, LB
. Lenti-dCas9-KRAB-blast Description
Lenti-dCas9-KRAB-blast is a lentivirus overexpression plasmid, and the EF-1 alpha promoter drives the expression of the dCas9-KRAB protein fragment. It can be used in the gene editing experiment of mammalian cells. References to essential granules are: Multiplexed Engineering and Analysis of Combinatorial Enhancer Activity in Single Cells. | |
PVT12069 | LENTI-EF1A-DCAS9-KRAB-PURO VECTOR | Packing 2ug | . lenti-EF1a-dCas9-KRAB-Puro vector Information:
. Product Name: lenti-EF1a-dCas9-KRAB-Puro vector
. Bacterial Resistance: Amp
. Selectable markers: Puro
. Growth Strain: Stbl3
. Growth Temperature: LB/37Centigrade degree
. Copy number: High Copy
. 5′ sequencing primer: GTTTGGATCTTGGTTCATTCTCAAGCCTCAG
. 3′ sequencing primer: cacatagcgtaaaaggagcaacatag
. Caution:
Product is for research use only! | |
PVT20093 | LENTI-EF1A-DCAS9-VPR-PURO | Packing 2ug | . Promoter: EF1a
. Replicon: pUC
. Prokaryotic resistance: Amp
. Host: mammalian cells
. Vector type: Gene editing
. Fragment type: CRISPR
. species:
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only | |
PVT20009 | LENTI-EF1A-LINC00595-DELTA383-426-PURO | Packing 2ug | . Promoter: EF1a
. Replicon: pUC
. Prokaryotic resistance: Amp
. Host: lentiviral plasmid
. Vector type: Transcriptional regulation
. Fragment type: ncRNA
. species: Human
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only | |
PVT20037 | LENTI-EF1A-LINC00595-DELTA588-624-PURO | Packing 2ug | . Promoter: EF1a
. Replicon: pUC
. Prokaryotic resistance: Amp
. Host: lentiviral plasmid
. Vector type: Transcriptional regulation
. Fragment type: ncRNA
. species: Human
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only | |
PVT28136 | LENTI-EF1A-SLC5A5-FLAG-T2A-EGFP-PGK-PURO | Packing 2ug | . Lenti-EF1a-SLC5A5-FLAG-T2A-EGFP-PGK-Puro Information
. Alternative name: NM_000453.3;NIS; TDH1
. Promoter: EF1a
. Replicator: pUC
. Clone strain: Stbl3
. Culture conditions: 37centigrade
. Note: 1929bp
. Lenti-EF1a-SLC5A5-FLAG-T2A-EGFP-PGK-Puro Description
. Host: Mammalian cells,Lentivirus
. Use: Protein expression
. Species:
. Gene type: ORF
. Prokaryotic resistance: Amp
. Eukaryotic resistance: Puro
. Fluorescent protein: Green
. Caution:
1. This product is FOR RESEARCH USE ONLY!
2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20ulddH2O in to the tube of plasmid.
3. (human); | |
PVT46534 | LENTI-ICAS9-NEO PLASMID | Packing 2ug | . Promoter:Tet
. Replicon:pUC
. Competent cells:Stbl3
. Culture temperature:37 degrees
. Host:Mammalian cells,Lentivirus
. Plasmid use(s):Gene knockout
. Fragment type:CRISPR
. Fragment species:
. Prokaryotic resistance:Amp
. Selectable marker: Neo/G418
. Note: Plasmid 85400;
. Caution:
1. This product is FOR RESEARCH USE ONLY!
2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid. | |
PVT32797 | LENTI-LUCIFERASE-P2A-NEO | Packing 2ug | . Alias:L-105621
. Promoter:EFS
. Replicator:pUC
. Clone strain:Stbl3
. Culture conditions:37centigrade
. Host:mammalian cells,Lentivirus
. Use:Protein expression
. Species:
. Gene type:ORF
. Prokaryotic resistance:Amp
. Eukaryotic resistance:G418
. Fluorescent protein:fLuc | |
PVT51011 | LENTI-SFFV-PPP2R2B-P2A-PURO PLASMID | Packing 2ug | . Lenti-SFFV-PPP2R2B-P2A-Puro PlasmidAlias:NM_181674.3;B55BETA; PP2AB55BETA; PP2ABBETA; PP2APR55B;PP2APR55BETA; PR2AB55BETA; PR2ABBETA; PR2APR55BETA; PR52B;PR55-BETA; PR55BETA; SCA12
. Gene length:1527bp
. Host: mammalian cells,Lentivirus
. Use(s): Protein expressionFragment Type: ORF
. Fragmented species: Human
. Prokaryotic resistance: Amp
. Screening Markers: Puro
. Green
. Promoter: SFFV
. replicon: pUC
. Copy Number:
. Competent cells: Stbl3
. Temperature: 37Degrees
. Back Bones:
. Forward primer:
. Reverse primer: | |
PVT10979 | LENTICAS9- EGFP | Packing 2ug | . LentiCas9-EGFP Information:
. Function Mammal Editing plasmids
. Resistance Amp
. Screen Zeo
. Strain Stbl3
. Culture temperature 37degrees centigrade
. Promoter: EF-1 alpha core promoter
. Copier: Ori, F1 ori, SV40 ori
. Terminator: WPRE
. Plasmid classification: mammalian cell plasmid; mammalian editing plasmid; mammalian Cas9 plasmid
. Plasmid size: 13177 BP
. Plasmid tags: C-nucleoplasmin NLS, C-FLAG, C-EGFP
. Prokaryotic resistance: ampicillin Amp
. Screening Marker: Bleomycin Zeo
. Cloning strain: Escherichia coli Stbl3
. Culture conditions: 37 C, aerobic, LB
. Expressing host: mammalian cells such as 293T
. LentiCas9-EGFP Description
. Expresses human codon-optimized S. pyogenes Cas9 protein and EGFP from EFS promoter. 3rd generation lentiviral backbone.
. LentiCas9-EGFP Reference
. Genome-wide CRISPR screen in a mouse model of tumor growth and metastasis. | |
PVTY00170 | LENTICAS9-BLAST | Packing 2ug | . lentiCas9-Blast Description
. Plasmid type:Lentiviral vector
. There are currently no product reviews. | |
PVT6314 | LENTICRISPR V1.0 | Packing 2ug | . Alternative Name: lentiCRISPR; lentiCRISPR V1
. Promoter: U6
. Replicator: pUC
. Prokaryotic resistance: Amp
. Filter marker: Puro
. Clone strain: stbl3
. Culture condition: 37 ℃
. Vector host: mammalian cells, lentivirus
. Application of vector: gene editing
. Gene species: empty body
. Gene type: CRISPR
. Prokaryotic resistance: Amp
. Eukaryotic resistance: Puro
. Use:CRISPR-CAS23-sgRNA plasmid | |
PVTY00143 | LENTICRISPR V2 | Packing 2ug | . Plasmid type:CRISPR-Cas9
. systemSize:14873 bp
. Resistance(s):AmpicillinSelectable
. markers:Puromycin
. Caution:
1. This product is FOR RESEARCH USE ONLY! | |
PVT40201 | LENTICRISPR V2-BLAST PLASMID | Packing 2ug | . Promoter:U6
. Replicon:pUC
. Competent cells:Stbl3
. Culture temperature:37 degrees
. Host:Mammalian cells,Lentivirus
. Plasmid use(s):Gene knockout
. Fragment type:CRISPR,Cas9,sgRNA
. Fragment species:empty vector
. Prokaryotic resistance:Amp
. Selectable marker: Blast
. Note: Plasmid 83480;
. Caution:
1. This product is FOR RESEARCH USE ONLY!
2. The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid. | |
PVT24225 | LENTICRISPR V2-CONTROL-SGRNA | Packing 2ug | . Product Name:LentiCRISPR V2-control-sgRNA
. Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species:
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only | |
PVT23084 | LENTICRISPR V2-CRACD-SGRNA1 | Packing 2ug | . Product Name:LentiCRISPR V2-CRACD-sgRNA1
. Replicon: pUC
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Human
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only | |
PVT23087 | LENTICRISPR V2-CRACD-SGRNA3 | Packing 2ug | . Product Name:LentiCRISPR V2-CRACD-sgRNA3
. Replicon: pUC
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Human
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only | |
PVT23634 | LENTICRISPR V2-DHODH-SGRNA2 | Packing 2ug | . Product Name:LentiCRISPR V2-DHODH-sgRNA2
. Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Human
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only | |
PVT24222 | LENTICRISPR V2-TRPC5-SGRNA2 | Packing 2ug | . Product Name:LentiCRISPR V2-TRPC5-sgRNA2
. Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Mouse
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only | |
PVT24224 | LENTICRISPR V2-TRPV2-SGRNA1 | Packing 2ug | . Product Name:LentiCRISPR V2-Trpv2-sgRNA1
. Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Mouse
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only | |
PVT24223 | LENTICRISPR V2-TRPV2-SGRNA2 | Packing 2ug | . Product Name:LentiCRISPR V2-Trpv2-sgRNA2
. Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Mouse
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only | |
PVT6315 | LENTICRISPR V2.0 | Packing 2ug | . Plasmid type: Cas9 editing plasmids of mammalian cells
. Cloned strain: Escherichia coli Stbl3
. Prokaryotic resistance: ampicillin Amp (100 u g/ml)
. Screening markers: purinomycin Puro
. Use:CRISPR-CAS24-sgRNA plasmid | |
PVT20751 | LENTICRISPRV2 HYGRO | Packing 2ug | . Product Name:LentiCRISPRv2 hygro
. Promoter: U6
. Replicon: pUC
. Prokaryotic resistance: Amp
. Host: lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR
. species: empty vector
. Prokaryotic resistance: Amp
. Resistance Marker: Hyg
. Fluorescent labeling:
. For Lab research use only | |
PVT17089 | LENTICRISPRV2 NEO PLASMID | Packing 2ug | . Promoter U6
. Prokaryotic resistance Amp
. Screening marker G418
. Clone strain Stbl3
. Culture Conditions LB/37 Celsius degree
. Forward primer U6
. Reverse primer
. lentiCRISPRv2 neo Plasmid Description
. lentiCRISPRv2 neo Plasmid is a Lactation editing plasmid
. NOTE: For research use only! | |
PVT25768 | LENTICRISPRV2- ANO6-SGRNA1 | Packing 2ug | . Product Name:LentiCRISPRV2- Ano6-sgRNA1
. Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Mouse
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only | |
PVT25767 | LENTICRISPRV2- ANO6-SGRNA2 | Packing 2ug | . Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Mouse
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only | |
PVT25785 | LENTICRISPRV2-ANO1-SGRNA1 | Packing 2ug | . Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Mouse
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only | |
PVT25783 | LENTICRISPRV2-ANO1-SGRNA2 | Packing 2ug | . Product Name:LentiCRISPRV2-Ano1-sgRNA2
. Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Mouse
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only | |
PVT25786 | LENTICRISPRV2-ANO10-SGRNA1 | Packing 2ug | . Product Name:LentiCRISPRV2-Ano10-sgRNA1
. Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Mouse
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only | |
PVT25780 | LENTICRISPRV2-ANO10-SGRNA2 | Packing 2ug | . Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Mouse
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only | |
PVT25605 | LENTICRISPRV2-CRACD-SGRNA2 | Packing 2ug | . Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Human
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only | |
PVT25784 | LENTICRISPRV2-DHODH-SGRNA1 | Packing 2ug | . Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Human
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only | |
PVT25782 | LENTICRISPRV2-KCNH2-SGRNA1 | Packing 2ug | . Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Mouse
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only | |
PVT25781 | LENTICRISPRV2-KCNH2-SGRNA2 | Packing 2ug | . Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Mouse
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only | |
PVT15983 | LENTICRISPRV2-SQSTM1SGRNA1 PLASMID | Packing 2ug | . LentiCRISPRV2-SQSTM1sgRNA1 PlasmidInformation
. Promoter
. Prokaryotic resistance Amp
. Screening marker Puro
. Clone strain DH5a
. Culture Conditions LB/37 Celsius degree
. Forward primer
. Reverse primer
. LentiCRISPRV2-SQSTM1sgRNA1 Plasmid Description
. LentiCRISPRV2-SQSTM1sgRNA1 Plasmid is a RNA transcription plasmid
. NOTE: For research use only! | |
PVT15944 | LENTICRISPRV2-SQSTM1SGRNA2 PLASMID | Packing 2ug | . Promoter
. Prokaryotic resistance Amp
. Screening marker Puro
. Clone strain DH5a
. Culture Conditions LB/37 Celsius degree
. Forward primer
. Reverse primer
. LentiCRISPRV2-SQSTM1sgRNA2 Plasmid Description
. LentiCRISPRV2-SQSTM1sgRNA2 Plasmid is a RNA transcription plasmid
. NOTE: For research use only! | |
PVT25770 | LENTICRISPRV2-TRPC1-SGRNA1 | Packing 2ug | . Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Mouse
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only | |
PVT25769 | LENTICRISPRV2-TRPC1-SGRNA2 | Packing 2ug | . Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Mouse
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only | |
PVT25787 | LENTICRISPRV2-TRPC5-SGRNA1 | Packing 2ug | . Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Mouse
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only | |
PVT25458 | LENTICRISPRV2-TRPC6-SGRNA1 | Packing 2ug | . Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Mouse
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only | |
PVT25773 | LENTICRISPRV2-TRPC6-SGRNA2 | Packing 2ug | . Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Mouse
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only | |
PVT25772 | LENTICRISPRV2-TRPM2-SGRNA1 | Packing 2ug | . Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Mouse
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only | |
PVT25771 | LENTICRISPRV2-TRPM2-SGRNA2 | Packing 2ug | . Replicon: pUC
. Growth Strain(s): Stbl3
. Culture conditions: 37Centigrade
. Host: mammalian cells,lentiviral plasmid
. Vector type: Gene editing
. Fragment type: CRISPR,Cas9,sgRNA
. species: Mouse
. Prokaryotic resistance: Amp
. Resistance Marker: Puro
. Fluorescent labeling:
. For Lab research use only |